Incidental Mutation 'R2360:Vmn2r87'
ID247120
Institutional Source Beutler Lab
Gene Symbol Vmn2r87
Ensembl Gene ENSMUSG00000091511
Gene Namevomeronasal 2, receptor 87
SynonymsEG625131
MMRRC Submission 040342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2360 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130471332-130497379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130479762 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 145 (T145K)
Ref Sequence ENSEMBL: ENSMUSP00000129215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164227]
Predicted Effect probably damaging
Transcript: ENSMUST00000164227
AA Change: T145K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129215
Gene: ENSMUSG00000091511
AA Change: T145K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 422 1.8e-27 PFAM
Pfam:NCD3G 508 562 1.8e-19 PFAM
Pfam:7tm_3 595 829 8.8e-55 PFAM
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,334,647 I1488M probably benign Het
4930432E11Rik A T 7: 29,574,789 noncoding transcript Het
Abca14 A G 7: 120,251,208 E761G probably benign Het
Apc C T 18: 34,261,126 T35I probably damaging Het
Arhgef2 T A 3: 88,634,416 I228N probably damaging Het
Atp6v1g2 A G 17: 35,237,662 E74G probably damaging Het
C330027C09Rik C T 16: 49,017,465 Q843* probably null Het
Ccdc70 A G 8: 21,973,431 E79G probably damaging Het
Cdc42ep4 A G 11: 113,728,702 S288P probably damaging Het
Cpn2 T C 16: 30,259,503 D460G probably benign Het
Crtam A G 9: 40,973,515 *393Q probably null Het
Cwc22 A G 2: 77,927,247 I179T probably damaging Het
Cyp3a41b T C 5: 145,570,411 M240V probably benign Het
Dnah8 A T 17: 30,677,204 D864V probably benign Het
Map3k7 T C 4: 31,964,302 S14P unknown Het
Med25 A G 7: 44,885,142 S150P probably damaging Het
Mex3b T C 7: 82,867,862 V71A probably benign Het
Morc3 T C 16: 93,841,387 L19S probably damaging Het
Morn1 T A 4: 155,092,313 S98T probably damaging Het
Mthfd1l G T 10: 4,056,771 A678S probably damaging Het
Napa A G 7: 16,114,158 Y200C probably damaging Het
Nr5a2 T C 1: 136,948,827 I33V probably benign Het
Olfr127 A G 17: 37,904,454 K303E possibly damaging Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Phf20l1 G A 15: 66,594,920 R66Q probably damaging Het
Rfk A G 19: 17,398,596 T85A probably benign Het
Sbno2 T C 10: 80,058,021 D1179G possibly damaging Het
Serpina3k C T 12: 104,340,907 Q133* probably null Het
Setd4 T C 16: 93,586,234 probably benign Het
Sh2d4b C T 14: 40,860,591 probably null Het
Slc1a6 G A 10: 78,812,884 V480I possibly damaging Het
Slc39a3 A T 10: 81,031,270 V214E possibly damaging Het
Tll1 A G 8: 64,051,401 Y654H probably damaging Het
Traf3ip1 T A 1: 91,499,652 C115S unknown Het
Vmn1r209 T A 13: 22,805,666 I285F probably damaging Het
Zan T C 5: 137,396,126 T4484A unknown Het
Zfp768 T C 7: 127,344,638 E106G probably benign Het
Zfp984 A G 4: 147,754,777 I539T possibly damaging Het
Other mutations in Vmn2r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r87 APN 10 130497378 start codon destroyed probably null 1.00
IGL01295:Vmn2r87 APN 10 130472009 missense probably damaging 1.00
IGL01411:Vmn2r87 APN 10 130472560 missense probably benign 0.03
IGL01680:Vmn2r87 APN 10 130479717 nonsense probably null
IGL01822:Vmn2r87 APN 10 130472122 missense probably damaging 1.00
IGL01835:Vmn2r87 APN 10 130479109 missense probably damaging 1.00
IGL01965:Vmn2r87 APN 10 130479055 missense possibly damaging 0.49
IGL02562:Vmn2r87 APN 10 130478644 missense probably damaging 1.00
IGL02665:Vmn2r87 APN 10 130497180 missense probably benign 0.16
IGL03202:Vmn2r87 APN 10 130497222 missense probably benign
FR4304:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4340:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4342:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4589:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
LCD18:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
R0344:Vmn2r87 UTSW 10 130479937 missense probably damaging 1.00
R0374:Vmn2r87 UTSW 10 130471979 missense probably damaging 1.00
R0384:Vmn2r87 UTSW 10 130471843 missense probably benign
R1144:Vmn2r87 UTSW 10 130476229 splice site probably benign
R1172:Vmn2r87 UTSW 10 130477584 missense probably benign 0.03
R1860:Vmn2r87 UTSW 10 130479886 missense probably benign 0.00
R1866:Vmn2r87 UTSW 10 130472572 missense possibly damaging 0.88
R1897:Vmn2r87 UTSW 10 130471960 missense probably damaging 1.00
R2909:Vmn2r87 UTSW 10 130478996 missense probably damaging 0.99
R3874:Vmn2r87 UTSW 10 130479987 missense possibly damaging 0.62
R4113:Vmn2r87 UTSW 10 130479822 missense probably benign
R4190:Vmn2r87 UTSW 10 130472687 missense probably damaging 1.00
R4197:Vmn2r87 UTSW 10 130479910 missense possibly damaging 0.55
R4201:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4202:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4368:Vmn2r87 UTSW 10 130479807 missense probably benign 0.44
R4485:Vmn2r87 UTSW 10 130479809 nonsense probably null
R4537:Vmn2r87 UTSW 10 130472185 missense probably benign 0.12
R4590:Vmn2r87 UTSW 10 130479145 missense possibly damaging 0.69
R4752:Vmn2r87 UTSW 10 130478467 nonsense probably null
R4873:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4875:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4923:Vmn2r87 UTSW 10 130478566 missense probably damaging 0.99
R4970:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5049:Vmn2r87 UTSW 10 130472429 missense probably damaging 0.96
R5112:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5187:Vmn2r87 UTSW 10 130497339 missense probably null 0.99
R5618:Vmn2r87 UTSW 10 130479948 missense probably damaging 1.00
R6057:Vmn2r87 UTSW 10 130472357 missense probably benign 0.02
R6220:Vmn2r87 UTSW 10 130479938 missense probably benign 0.01
R6287:Vmn2r87 UTSW 10 130478422 critical splice donor site probably null
R6383:Vmn2r87 UTSW 10 130479000 missense probably damaging 1.00
R6576:Vmn2r87 UTSW 10 130478785 missense probably benign 0.05
R6742:Vmn2r87 UTSW 10 130472527 missense probably damaging 1.00
Z1088:Vmn2r87 UTSW 10 130472314 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGTTTGCCCAGTAGATCTATG -3'
(R):5'- CTGATGAGATCAACAAGAATCCTGATC -3'

Sequencing Primer
(F):5'- GTTTGCCCAGTAGATCTATGATATG -3'
(R):5'- ATCCTGATCTTTTACCAAACACATC -3'
Posted On2014-10-30