Mutagenetix > Incidental Mutation

Incidental Mutation 'R2360:Atp6v1g2'

247134

Institutional Source

Beutler Lab

Gene Symbol

Atp6v1g2

Ensembl Gene

ENSMUSG00000024403

Gene Name

ATPase, H+ transporting, lysosomal V1 subunit G2

Synonyms

VAG2, lysosomal 13kDa, NG38, 1500002D01Rik, Atp6g2

MMRRC Submission

040342-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35453910-35457743 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35456638 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 74 (E74G)

Ref Sequence

ENSEMBL: ENSMUSP00000069482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048994] [ENSMUST00000068056] [ENSMUST00000068261] [ENSMUST00000118384] [ENSMUST00000130992] [ENSMUST00000173731] [ENSMUST00000174757]

AlphaFold

Q9WTT4

Predicted Effect

probably benign
Transcript: ENSMUST00000048994

SMART Domains

Protein: ENSMUSP00000035452
Gene: ENSMUSG00000042419

Domain	Start	End	E-Value	Type
low complexity region	30	40	N/A	INTRINSIC
ANK	65	94	1.01e2	SMART
ANK	98	131	3.81e2	SMART
low complexity region	153	165	N/A	INTRINSIC
low complexity region	261	270	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000068056

SMART Domains

Protein: ENSMUSP00000070682
Gene: ENSMUSG00000019432

Domain	Start	End	E-Value	Type
DEXDc	64	265	7.17e-55	SMART
HELICc	301	382	1.48e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000068261
AA Change: E74G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069482
Gene: ENSMUSG00000024403
AA Change: E74G

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_G	3	107	3e-38	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118384
AA Change: E49G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113511
Gene: ENSMUSG00000024403
AA Change: E49G

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_G	1	82	1.2e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130992
AA Change: E33G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134733
Gene: ENSMUSG00000024403
AA Change: E33G

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_G	1	66	8.1e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143289

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174164

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174795

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146711

Predicted Effect

probably benign
Transcript: ENSMUST00000173731

SMART Domains

Protein: ENSMUSP00000133428
Gene: ENSMUSG00000019432

Domain	Start	End	E-Value	Type
DEXDc	64	265	7.17e-55	SMART
HELICc	301	382	1.48e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174757

SMART Domains

Protein: ENSMUSP00000133705
Gene: ENSMUSG00000019432

Domain	Start	End	E-Value	Type
DEXDc	1	147	2.85e-17	SMART

Meta Mutation Damage Score

0.2859

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

93% (37/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of three V1 domain G subunit proteins. This gene had previous gene symbols of ATP6G and ATP6G2. Alternatively spliced transcript variants encoding different isoforms have been described. Read-through transcription also exists between this gene and the downstream DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (DDX39B) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are produced in the expected ratio. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,274,214 (GRCm39)		noncoding transcript	Het
Abca14	A	G	7: 119,850,431 (GRCm39)	E761G	probably benign	Het
Apc	C	T	18: 34,394,179 (GRCm39)	T35I	probably damaging	Het
Arhgef2	T	A	3: 88,541,723 (GRCm39)	I228N	probably damaging	Het
Ccdc70	A	G	8: 22,463,447 (GRCm39)	E79G	probably damaging	Het
Cdc42ep4	A	G	11: 113,619,528 (GRCm39)	S288P	probably damaging	Het
Cip2a	C	T	16: 48,837,828 (GRCm39)	Q843*	probably null	Het
Cpn2	T	C	16: 30,078,321 (GRCm39)	D460G	probably benign	Het
Crtam	A	G	9: 40,884,811 (GRCm39)	*393Q	probably null	Het
Cwc22	A	G	2: 77,757,591 (GRCm39)	I179T	probably damaging	Het
Cyp3a41b	T	C	5: 145,507,221 (GRCm39)	M240V	probably benign	Het
Dnah8	A	T	17: 30,896,178 (GRCm39)	D864V	probably benign	Het
Map3k7	T	C	4: 31,964,302 (GRCm39)	S14P	unknown	Het
Med25	A	G	7: 44,534,566 (GRCm39)	S150P	probably damaging	Het
Mex3b	T	C	7: 82,517,070 (GRCm39)	V71A	probably benign	Het
Morc3	T	C	16: 93,638,275 (GRCm39)	L19S	probably damaging	Het
Morn1	T	A	4: 155,176,770 (GRCm39)	S98T	probably damaging	Het
Mthfd1l	G	T	10: 4,006,771 (GRCm39)	A678S	probably damaging	Het
Napa	A	G	7: 15,848,083 (GRCm39)	Y200C	probably damaging	Het
Nr5a2	T	C	1: 136,876,565 (GRCm39)	I33V	probably benign	Het
Or14j6	A	G	17: 38,215,345 (GRCm39)	K303E	possibly damaging	Het
Pcnx1	A	G	12: 81,996,960 (GRCm39)	D952G	probably damaging	Het
Phf20l1	G	A	15: 66,466,769 (GRCm39)	R66Q	probably damaging	Het
Resf1	A	G	6: 149,236,145 (GRCm39)	I1488M	probably benign	Het
Rfk	A	G	19: 17,375,960 (GRCm39)	T85A	probably benign	Het
Sbno2	T	C	10: 79,893,855 (GRCm39)	D1179G	possibly damaging	Het
Serpina3k	C	T	12: 104,307,166 (GRCm39)	Q133*	probably null	Het
Setd4	T	C	16: 93,383,122 (GRCm39)		probably benign	Het
Sh2d4b	C	T	14: 40,582,548 (GRCm39)		probably null	Het
Slc1a6	G	A	10: 78,648,718 (GRCm39)	V480I	possibly damaging	Het
Slc39a3	A	T	10: 80,867,104 (GRCm39)	V214E	possibly damaging	Het
Tll1	A	G	8: 64,504,435 (GRCm39)	Y654H	probably damaging	Het
Traf3ip1	T	A	1: 91,427,374 (GRCm39)	C115S	unknown	Het
Vmn1r209	T	A	13: 22,989,836 (GRCm39)	I285F	probably damaging	Het
Vmn2r87	G	T	10: 130,315,631 (GRCm39)	T145K	probably damaging	Het
Zan	T	C	5: 137,394,388 (GRCm39)	T4484A	unknown	Het
Zfp768	T	C	7: 126,943,810 (GRCm39)	E106G	probably benign	Het
Zfp984	A	G	4: 147,839,234 (GRCm39)	I539T	possibly damaging	Het

Other mutations in Atp6v1g2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R2094:Atp6v1g2	UTSW	17	35,455,785 (GRCm39)	missense	probably damaging	1.00
R2497:Atp6v1g2	UTSW	17	35,455,762 (GRCm39)	missense	probably damaging	1.00
R9612:Atp6v1g2	UTSW	17	35,456,733 (GRCm39)	missense	probably benign	0.00
R9627:Atp6v1g2	UTSW	17	35,454,956 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAAGGATTGTGCCCACCTGC -3'
(R):5'- ATTTCTCTGTGGACGGAGC -3'

Sequencing Primer
(F):5'- CCTGCTTGGTATCTACATGTTTTTG -3'
(R):5'- CTGACAGAAGGAGTCACTCTAG -3'

Posted On

2014-10-30