Incidental Mutation 'R2361:Ass1'
ID247140
Institutional Source Beutler Lab
Gene Symbol Ass1
Ensembl Gene ENSMUSG00000076441
Gene Nameargininosuccinate synthetase 1
SynonymsAss-1, ASS, fold
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2361 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31470207-31520672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31520382 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 402 (Y402H)
Ref Sequence ENSEMBL: ENSMUSP00000099904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102840]
Predicted Effect probably benign
Transcript: ENSMUST00000102840
AA Change: Y402H

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: Y402H

DomainStartEndE-ValueType
Pfam:QueC 6 93 2.8e-7 PFAM
Pfam:Arginosuc_synth 8 403 1.9e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130195
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G T 18: 70,469,575 Q56K probably damaging Het
Acrv1 A G 9: 36,698,550 N239S possibly damaging Het
Acss2 A G 2: 155,558,669 K543E probably damaging Het
Agbl3 A G 6: 34,832,505 D689G possibly damaging Het
Atr A G 9: 95,871,157 H683R probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cacna1h C A 17: 25,384,012 V1445F probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Lce1k T A 3: 92,806,584 S98C unknown Het
Lrrc9 T C 12: 72,463,470 C448R possibly damaging Het
Map3k13 A G 16: 21,906,536 T420A probably benign Het
Megf8 A G 7: 25,348,954 D1684G possibly damaging Het
Nacad T C 11: 6,600,821 H790R probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Nt5e T C 9: 88,370,237 S551P possibly damaging Het
Ptgs2 T C 1: 150,103,975 V277A probably benign Het
Slc34a2 T A 5: 53,068,145 F411L probably benign Het
Slc4a1 T C 11: 102,356,830 Y409C probably damaging Het
Other mutations in Ass1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ass1 APN 2 31476922 missense probably damaging 1.00
IGL02152:Ass1 APN 2 31492324 missense probably damaging 1.00
R0008:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0083:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0084:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0085:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0087:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0183:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0220:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0254:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0302:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0346:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0440:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0472:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0605:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0644:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R1460:Ass1 UTSW 2 31514741 missense probably benign 0.37
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1770:Ass1 UTSW 2 31486516 missense probably benign 0.29
R1908:Ass1 UTSW 2 31493148 nonsense probably null
R2430:Ass1 UTSW 2 31501496 missense probably damaging 1.00
R3816:Ass1 UTSW 2 31510105 splice site probably benign
R4614:Ass1 UTSW 2 31514783 missense probably damaging 1.00
R4628:Ass1 UTSW 2 31480988 missense probably damaging 1.00
R5007:Ass1 UTSW 2 31501532 missense possibly damaging 0.90
R5069:Ass1 UTSW 2 31510173 missense probably damaging 1.00
R5081:Ass1 UTSW 2 31488653 critical splice donor site probably null
R5315:Ass1 UTSW 2 31492329 missense probably benign 0.21
R5370:Ass1 UTSW 2 31518733 missense possibly damaging 0.56
R6259:Ass1 UTSW 2 31488642 missense possibly damaging 0.80
R6541:Ass1 UTSW 2 31510233 missense probably damaging 0.99
R6731:Ass1 UTSW 2 31514784 missense probably damaging 1.00
R6927:Ass1 UTSW 2 31514801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAAACAATGTTTTCCCCTCTG -3'
(R):5'- CCACTTTTGTAGGCTATAGGGGAC -3'

Sequencing Primer
(F):5'- TGGAGGAGCCAGGGGAG -3'
(R):5'- CCAGGGAACAAAGGCTGTG -3'
Posted On2014-10-30