Incidental Mutation 'R2362:Wbp11'
ID247178
Institutional Source Beutler Lab
Gene Symbol Wbp11
Ensembl Gene ENSMUSG00000030216
Gene NameWW domain binding protein 11
SynonymsNpwbp, SIPP1, 2510026P17Rik, D6Wsu113e
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136813654-136828233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136824332 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 63 (M63K)
Ref Sequence ENSEMBL: ENSMUSP00000112213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052702] [ENSMUST00000116514] [ENSMUST00000146348] [ENSMUST00000204086] [ENSMUST00000204272]
Predicted Effect probably benign
Transcript: ENSMUST00000052702
SMART Domains Protein: ENSMUSP00000049512
Gene: ENSMUSG00000047515

DomainStartEndE-ValueType
Pfam:DUF4533 8 235 1.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116514
AA Change: M63K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112213
Gene: ENSMUSG00000030216
AA Change: M63K

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 1e-26 PFAM
low complexity region 191 209 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
low complexity region 380 532 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141598
Predicted Effect probably benign
Transcript: ENSMUST00000146348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151333
Predicted Effect probably benign
Transcript: ENSMUST00000204086
Predicted Effect probably benign
Transcript: ENSMUST00000204129
Predicted Effect probably damaging
Transcript: ENSMUST00000204272
AA Change: M63K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145501
Gene: ENSMUSG00000030216
AA Change: M63K

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 3.8e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205058
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Wbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Wbp11 APN 6 136821670 intron probably benign
IGL01408:Wbp11 APN 6 136814614 unclassified probably benign
R0639:Wbp11 UTSW 6 136816110 unclassified probably benign
R0685:Wbp11 UTSW 6 136814638 unclassified probably benign
R1264:Wbp11 UTSW 6 136814515 unclassified probably benign
R1987:Wbp11 UTSW 6 136820585 missense probably damaging 0.99
R4646:Wbp11 UTSW 6 136821191 missense probably benign 0.10
R5682:Wbp11 UTSW 6 136814254 unclassified probably benign
R6045:Wbp11 UTSW 6 136821535 missense probably damaging 0.99
R6386:Wbp11 UTSW 6 136820525 missense probably benign 0.36
R6567:Wbp11 UTSW 6 136820539 missense probably benign 0.02
R7132:Wbp11 UTSW 6 136821542 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGAGGTCTCTAGCTTGCAAC -3'
(R):5'- AGAATTCTCAGCTGTTTCTAGAGG -3'

Sequencing Primer
(F):5'- AGGTCTCTAGCTTGCAACAGTCTATC -3'
(R):5'- TTCTTCTTAGACTCTTGAGGCAAAGG -3'
Posted On2014-10-30