Incidental Mutation 'R2362:Polr3e'
ID247184
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Namepolymerase (RNA) III (DNA directed) polypeptide E
SynonymsSin, RPC5
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120917744-120947432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 120942564 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 623 (D623E)
Ref Sequence ENSEMBL: ENSMUSP00000146970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
Predicted Effect probably damaging
Transcript: ENSMUST00000033173
AA Change: D649E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: D649E

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106483
AA Change: D649E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: D649E

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207481
AA Change: D623E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209014
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120940811 nonsense probably null
IGL01664:Polr3e APN 7 120931317 splice site probably benign
IGL01980:Polr3e APN 7 120940296 splice site probably benign
IGL02027:Polr3e APN 7 120930963 missense probably damaging 1.00
IGL02208:Polr3e APN 7 120932140 missense probably damaging 0.99
IGL02549:Polr3e APN 7 120939759 missense probably damaging 1.00
IGL03338:Polr3e APN 7 120937620 missense probably benign 0.06
R1192:Polr3e UTSW 7 120933308 missense probably benign 0.03
R1328:Polr3e UTSW 7 120933823 splice site probably benign
R1435:Polr3e UTSW 7 120940788 missense probably benign 0.16
R1528:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R1754:Polr3e UTSW 7 120939298 critical splice donor site probably null
R1924:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R2169:Polr3e UTSW 7 120932137 missense probably damaging 1.00
R2201:Polr3e UTSW 7 120932242 missense probably benign
R2696:Polr3e UTSW 7 120933377 missense probably damaging 1.00
R4416:Polr3e UTSW 7 120939057 critical splice donor site probably null
R5278:Polr3e UTSW 7 120922961 missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120922949 missense possibly damaging 0.83
R5689:Polr3e UTSW 7 120940689 missense possibly damaging 0.82
R5790:Polr3e UTSW 7 120927967 missense probably damaging 1.00
R6242:Polr3e UTSW 7 120940467 missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120927982 missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120927999 missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120944650 missense probably damaging 0.98
R7110:Polr3e UTSW 7 120940287 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATTGCAGATTCCTCAGAGCC -3'
(R):5'- ATAGCGAGGCCACCATACTC -3'

Sequencing Primer
(F):5'- ATTCCTCAGAGCCAGTGAGTG -3'
(R):5'- CAAAGGTGATTCTGTGCTAATTTGGC -3'
Posted On2014-10-30