Incidental Mutation 'R2362:Cdr2'
ID247185
Institutional Source Beutler Lab
Gene Symbol Cdr2
Ensembl Gene ENSMUSG00000030878
Gene Namecerebellar degeneration-related 2
Synonyms
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120957036-120982312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120970331 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 62 (I62L)
Ref Sequence ENSEMBL: ENSMUSP00000033169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033169] [ENSMUST00000140247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033169
AA Change: I62L

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033169
Gene: ENSMUSG00000030878
AA Change: I62L

DomainStartEndE-ValueType
low complexity region 22 31 N/A INTRINSIC
coiled coil region 37 141 N/A INTRINSIC
coiled coil region 191 258 N/A INTRINSIC
coiled coil region 345 374 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140247
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile, and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Cdr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Cdr2 APN 7 120958549 missense probably damaging 0.99
R0394:Cdr2 UTSW 7 120958731 missense probably benign 0.00
R0975:Cdr2 UTSW 7 120958391 missense probably benign 0.07
R1781:Cdr2 UTSW 7 120958045 missense probably benign 0.01
R1906:Cdr2 UTSW 7 120982001 missense probably damaging 1.00
R2124:Cdr2 UTSW 7 120982027 missense probably damaging 1.00
R2273:Cdr2 UTSW 7 120958509 missense possibly damaging 0.71
R2274:Cdr2 UTSW 7 120958509 missense possibly damaging 0.71
R2275:Cdr2 UTSW 7 120958509 missense possibly damaging 0.71
R4783:Cdr2 UTSW 7 120958421 missense probably benign 0.00
R5269:Cdr2 UTSW 7 120958334 missense possibly damaging 0.95
R5403:Cdr2 UTSW 7 120958745 nonsense probably null
R5650:Cdr2 UTSW 7 120958336 missense probably damaging 0.96
R5923:Cdr2 UTSW 7 120982001 missense probably damaging 1.00
R6384:Cdr2 UTSW 7 120982128 unclassified probably null
R7073:Cdr2 UTSW 7 120982024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATACTTACCTACTAGGCACATC -3'
(R):5'- ACCTGACTTGCATGTGTGGG -3'

Sequencing Primer
(F):5'- CTAGGCACATCTAAAGAAAGTGTC -3'
(R):5'- GGGCTTGCTTCATTTACTTTAAGAAC -3'
Posted On2014-10-30