Incidental Mutation 'R2362:Slc10a7'
ID247188
Institutional Source Beutler Lab
Gene Symbol Slc10a7
Ensembl Gene ENSMUSG00000031684
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms2410193C02Rik
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location78509346-78734003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78509632 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 20 (I20V)
Ref Sequence ENSEMBL: ENSMUSP00000147396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034111] [ENSMUST00000049245] [ENSMUST00000209490] [ENSMUST00000209992] [ENSMUST00000210515] [ENSMUST00000210630] [ENSMUST00000211286] [ENSMUST00000211719]
Predicted Effect probably damaging
Transcript: ENSMUST00000034111
AA Change: I20V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034111
Gene: ENSMUSG00000031684
AA Change: I20V

DomainStartEndE-ValueType
Pfam:SBF_like 10 324 1.9e-82 PFAM
Pfam:SBF 44 224 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049245
SMART Domains Protein: ENSMUSP00000048153
Gene: ENSMUSG00000037070

DomainStartEndE-ValueType
RRM 9 82 2.31e-28 SMART
low complexity region 91 124 N/A INTRINSIC
low complexity region 145 168 N/A INTRINSIC
Pfam:RBM1CTR 170 214 5.5e-26 PFAM
low complexity region 215 231 N/A INTRINSIC
low complexity region 236 271 N/A INTRINSIC
low complexity region 300 338 N/A INTRINSIC
low complexity region 352 387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209490
AA Change: I20V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209992
AA Change: I20V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210515
AA Change: I20V

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000210630
AA Change: I20V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211286
AA Change: I20V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211332
Predicted Effect probably benign
Transcript: ENSMUST00000211719
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Slc10a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Slc10a7 APN 8 78698580 splice site probably benign
IGL01589:Slc10a7 APN 8 78729740 missense probably damaging 0.98
IGL01868:Slc10a7 APN 8 78697336 splice site probably null
IGL02197:Slc10a7 APN 8 78515663 missense probably damaging 0.98
IGL02205:Slc10a7 APN 8 78697303 missense probably benign 0.04
IGL03128:Slc10a7 APN 8 78525217 missense probably damaging 1.00
R0123:Slc10a7 UTSW 8 78697158 splice site probably null
R0134:Slc10a7 UTSW 8 78697158 splice site probably null
R1973:Slc10a7 UTSW 8 78697333 critical splice donor site probably null
R2266:Slc10a7 UTSW 8 78509635 missense probably benign 0.02
R4756:Slc10a7 UTSW 8 78706950 critical splice donor site probably null
R5454:Slc10a7 UTSW 8 78686624 missense possibly damaging 0.71
R5753:Slc10a7 UTSW 8 78525299 critical splice donor site probably null
R6621:Slc10a7 UTSW 8 78515634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTTGCTCTGCTGCATG -3'
(R):5'- TGATTGCCCGCAGAAAAGG -3'

Sequencing Primer
(F):5'- CTCTGCTGCATGTCTGGAG -3'
(R):5'- TCCTGGGCTAGCAAGTGAG -3'
Posted On2014-10-30