Incidental Mutation 'R2362:Stambpl1'
ID247201
Institutional Source Beutler Lab
Gene Symbol Stambpl1
Ensembl Gene ENSMUSG00000024776
Gene NameSTAM binding protein like 1
Synonyms1700095N21Rik, 8230401J17Rik
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34192229-34240333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34236354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 328 (V328I)
Ref Sequence ENSEMBL: ENSMUSP00000112938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631] [ENSMUST00000054956] [ENSMUST00000119603] [ENSMUST00000129535]
Predicted Effect probably benign
Transcript: ENSMUST00000039631
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054956
AA Change: V328I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059927
Gene: ENSMUSG00000024776
AA Change: V328I

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 132 3e-21 PFAM
coiled coil region 149 176 N/A INTRINSIC
JAB_MPN 268 394 4.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119603
AA Change: V328I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112938
Gene: ENSMUSG00000024776
AA Change: V328I

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 132 3.9e-21 PFAM
coiled coil region 149 176 N/A INTRINSIC
JAB_MPN 268 394 4.29e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125232
Predicted Effect probably benign
Transcript: ENSMUST00000129535
SMART Domains Protein: ENSMUSP00000115333
Gene: ENSMUSG00000024776

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 112 5.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130756
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Stambpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Stambpl1 APN 19 34240030 missense probably damaging 1.00
IGL01779:Stambpl1 APN 19 34240027 missense possibly damaging 0.83
IGL01817:Stambpl1 APN 19 34233993 missense possibly damaging 0.67
IGL02582:Stambpl1 APN 19 34235212 missense probably benign 0.01
R1639:Stambpl1 UTSW 19 34236307 missense probably benign 0.11
R1707:Stambpl1 UTSW 19 34238821 missense probably damaging 1.00
R1732:Stambpl1 UTSW 19 34226721 missense probably damaging 0.99
R1768:Stambpl1 UTSW 19 34226721 missense probably damaging 0.99
R1887:Stambpl1 UTSW 19 34236408 missense probably benign 0.38
R2150:Stambpl1 UTSW 19 34226704 missense probably damaging 1.00
R4342:Stambpl1 UTSW 19 34234046 missense probably benign 0.00
R4689:Stambpl1 UTSW 19 34236291 missense probably benign 0.11
R5533:Stambpl1 UTSW 19 34233916 intron probably null
R5647:Stambpl1 UTSW 19 34234286 missense probably benign 0.03
R6353:Stambpl1 UTSW 19 34234120 unclassified probably null
R6402:Stambpl1 UTSW 19 34234139 missense probably benign 0.00
R7334:Stambpl1 UTSW 19 34226648 missense probably damaging 1.00
R7413:Stambpl1 UTSW 19 34226716 missense probably damaging 1.00
Z1088:Stambpl1 UTSW 19 34226627 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATACAAGGGGTGAGGTCTGC -3'
(R):5'- GACAGATTTATACACAGCTTGGCATTG -3'

Sequencing Primer
(F):5'- TGCTGGCTGATGACATCC -3'
(R):5'- CACAGCTTGGCATTGAATAAATTGC -3'
Posted On2014-10-30