Incidental Mutation 'R2363:Maml2'
ID247227
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Namemastermind like transcriptional coactivator 2
Synonyms
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2363 (G1)
Quality Score151
Status Validated
Chromosome9
Chromosomal Location13297957-13709388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13621245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 585 (T585I)
Ref Sequence ENSEMBL: ENSMUSP00000124083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294]
Predicted Effect probably benign
Transcript: ENSMUST00000034401
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159294
AA Change: T585I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: T585I

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175351
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 unclassified probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5455:Maml2 UTSW 9 13705743 nonsense probably null
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13705835 missense possibly damaging 0.59
R6998:Maml2 UTSW 9 13621185 unclassified probably benign
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
R7233:Maml2 UTSW 9 13620771 missense
R7326:Maml2 UTSW 9 13621607 missense
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTACACGTACAAGGCCAGCC -3'
(R):5'- ATGAACTCTGTGGCTGTGGC -3'

Sequencing Primer
(F):5'- CTGGACACCTGGATGTGCTTC -3'
(R):5'- GCTGTGGCTGCTGCTGC -3'
Posted On2014-10-30