Incidental Mutation 'R2364:4930579F01Rik'
ID247260
Institutional Source Beutler Lab
Gene Symbol 4930579F01Rik
Ensembl Gene ENSMUSG00000012042
Gene NameRIKEN cDNA 4930579F01 gene
Synonyms
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138164078-138193825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138165823 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 268 (S268P)
Ref Sequence ENSEMBL: ENSMUSP00000012186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012186] [ENSMUST00000199293]
Predicted Effect probably benign
Transcript: ENSMUST00000012186
AA Change: S268P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000012186
Gene: ENSMUSG00000012042
AA Change: S268P

DomainStartEndE-ValueType
Pfam:SPATIAL 17 201 1.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199293
AA Change: S143P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142940
Gene: ENSMUSG00000012042
AA Change: S143P

DomainStartEndE-ValueType
Pfam:SPATIAL 1 76 9.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in 4930579F01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:4930579F01Rik APN 3 138186198 intron probably benign
IGL02121:4930579F01Rik APN 3 138164373 missense possibly damaging 0.93
IGL02424:4930579F01Rik APN 3 138174705 splice site probably benign
R0008:4930579F01Rik UTSW 3 138176585 missense possibly damaging 0.67
R0008:4930579F01Rik UTSW 3 138176585 missense possibly damaging 0.67
R0373:4930579F01Rik UTSW 3 138173582 missense probably damaging 0.96
R1082:4930579F01Rik UTSW 3 138173571 missense possibly damaging 0.95
R1163:4930579F01Rik UTSW 3 138176510 missense probably damaging 1.00
R1538:4930579F01Rik UTSW 3 138183756 missense probably damaging 1.00
R2151:4930579F01Rik UTSW 3 138176456 critical splice donor site probably null
R3978:4930579F01Rik UTSW 3 138183674 missense probably benign 0.01
R4108:4930579F01Rik UTSW 3 138183670 missense probably benign 0.14
R5812:4930579F01Rik UTSW 3 138176538 missense probably damaging 1.00
R5960:4930579F01Rik UTSW 3 138183767 missense possibly damaging 0.58
R6329:4930579F01Rik UTSW 3 138173696 missense probably damaging 1.00
R6599:4930579F01Rik UTSW 3 138176489 missense probably benign 0.00
R6862:4930579F01Rik UTSW 3 138186188 intron probably benign
R6897:4930579F01Rik UTSW 3 138183773 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGGGACACATTTCTGTCAACTC -3'
(R):5'- ACGATATGGTAAGAGCTGACCTC -3'

Sequencing Primer
(F):5'- TCTCTCAATGCAAAACTGAGCAGATG -3'
(R):5'- GGCCTGCTAGATATTTGCTCAAAG -3'
Posted On2014-10-30