Incidental Mutation 'R2312:Wnt10a'
ID247319
Institutional Source Beutler Lab
Gene Symbol Wnt10a
Ensembl Gene ENSMUSG00000026167
Gene Namewingless-type MMTV integration site family, member 10A
Synonyms
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74791516-74804179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74803430 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 355 (A355E)
Ref Sequence ENSEMBL: ENSMUSP00000006718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006718
AA Change: A355E

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006718
Gene: ENSMUSG00000026167
AA Change: A355E

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
WNT1 63 417 4.97e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187238
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit taurodontism, supernumerary molars, small molars and misshapened crowns. Mice homozygous for a conditional allele activated in Krt14+ cells also exhibit decreased basal cell proliferation affecting the tongue, sweat glands and nails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Other mutations in Wnt10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0347:Wnt10a UTSW 1 74793543 missense probably damaging 0.97
R3941:Wnt10a UTSW 1 74803497 unclassified probably null
R4683:Wnt10a UTSW 1 74803137 missense unknown
R4719:Wnt10a UTSW 1 74803603 missense probably damaging 1.00
R5218:Wnt10a UTSW 1 74793595 missense probably benign
R5244:Wnt10a UTSW 1 74803295 missense probably damaging 0.99
R5813:Wnt10a UTSW 1 74800596 missense probably damaging 1.00
R6652:Wnt10a UTSW 1 74803454 utr 3 prime probably null
R7278:Wnt10a UTSW 1 74793482 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAAGTGCAAATGCCACGGC -3'
(R):5'- AGCTTGGGTCTGCTCACTTG -3'

Sequencing Primer
(F):5'- TGAGTTCCGCACAGTAGGG -3'
(R):5'- TCACTTGCAGACGCTGAC -3'
Posted On2014-11-11