Incidental Mutation 'R2312:Ulk1'
ID247334
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Nameunc-51 like kinase 1
SynonymsUnc51.1
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110784488-110810097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110789357 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 691 (R691Q)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
Predicted Effect probably benign
Transcript: ENSMUST00000031490
AA Change: R685Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: R685Q

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198470
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect probably benign
Transcript: ENSMUST00000200299
AA Change: R691Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: R691Q

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110787872 missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110793011 missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110792404 missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110796234 splice site probably null
IGL02415:Ulk1 APN 5 110787621 missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110809134 missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110793052 missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110787707 splice site probably benign
R0092:Ulk1 UTSW 5 110796327 missense probably null 1.00
R0158:Ulk1 UTSW 5 110788944 splice site probably benign
R0387:Ulk1 UTSW 5 110788797 missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110791085 missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110789545 splice site probably benign
R1244:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1245:Ulk1 UTSW 5 110789340 critical splice donor site probably null
R1268:Ulk1 UTSW 5 110790277 missense probably damaging 1.00
R1342:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1586:Ulk1 UTSW 5 110789516 missense probably damaging 1.00
R1590:Ulk1 UTSW 5 110795766 missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110787831 missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110789381 missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110791070 missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110787151 missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110792436 missense probably benign 0.27
R2276:Ulk1 UTSW 5 110788162 missense probably benign 0.00
R2310:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2311:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2764:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2859:Ulk1 UTSW 5 110794629 missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3761:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4334:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4419:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4471:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4615:Ulk1 UTSW 5 110789046 missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110788947 critical splice donor site probably null
R4820:Ulk1 UTSW 5 110792130 missense probably benign
R4912:Ulk1 UTSW 5 110787589 missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110791097 missense possibly damaging 0.78
R6754:Ulk1 UTSW 5 110790393 missense possibly damaging 0.91
R7233:Ulk1 UTSW 5 110809042 missense probably damaging 1.00
X0025:Ulk1 UTSW 5 110792129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCCAGGCATAACTAGACTC -3'
(R):5'- GGGACTTTCTCAGTGCTGTC -3'

Sequencing Primer
(F):5'- GGCATAACTAGACTCAGCTTCAGTC -3'
(R):5'- TTTCCCTCCTAGGCCGGG -3'
Posted On2014-11-11