Incidental Mutation 'R2312:Lmtk2'
ID247335
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Namelemur tyrosine kinase 2
SynonymsAATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
MMRRC Submission 040311-MU
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144100436-144188204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144173626 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 388 (F388S)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
Predicted Effect probably damaging
Transcript: ENSMUST00000041804
AA Change: F388S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: F388S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2352:Lmtk2 UTSW 5 144173911 missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144166427 splice site probably benign
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144183226 missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144176447 missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144174919 missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTGCTGTAATCACACTCTGAG -3'
(R):5'- ATACTCAAAGCTCAGGCCCTG -3'

Sequencing Primer
(F):5'- GTTAAGCCCTTAACCGTGGCTAG -3'
(R):5'- TGGTCTCCGTCACCGTGAG -3'
Posted On2014-11-11