Incidental Mutation 'R2312:H1fx'
ID247338
Institutional Source Beutler Lab
Gene Symbol H1fx
Ensembl Gene ENSMUSG00000044927
Gene NameH1 histone family, member X
SynonymsLOC243529, H1X
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87980421-87981637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87981148 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 70 (Y70C)
Ref Sequence ENSEMBL: ENSMUSP00000060761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056403]
Predicted Effect probably damaging
Transcript: ENSMUST00000056403
AA Change: Y70C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060761
Gene: ENSMUSG00000044927
AA Change: Y70C

DomainStartEndE-ValueType
H15 40 107 1.74e-9 SMART
low complexity region 124 153 N/A INTRINSIC
low complexity region 159 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143871
SMART Domains Protein: ENSMUSP00000119119
Gene: ENSMUSG00000084950

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 65 86 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153372
SMART Domains Protein: ENSMUSP00000122496
Gene: ENSMUSG00000084950

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 65 86 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199539
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H1 family. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in H1fx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1370:H1fx UTSW 6 87981151 missense probably damaging 1.00
R1535:H1fx UTSW 6 87981148 missense probably damaging 1.00
R6823:H1fx UTSW 6 87981302 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGATGTCGCCAGACCGTAG -3'
(R):5'- CCATGTCGGTGGAGCTTGAG -3'

Sequencing Primer
(F):5'- ACTTTCTTCGCGCTGGCAG -3'
(R):5'- AGCTTGAGGAGGCCCTG -3'
Posted On2014-11-11