Incidental Mutation 'R2312:Rmnd1'
ID247348
Institutional Source Beutler Lab
Gene Symbol Rmnd1
Ensembl Gene ENSMUSG00000019763
Gene Namerequired for meiotic nuclear division 1 homolog
Synonyms
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #R2312 (G1)
Quality Score85
Status Not validated
Chromosome10
Chromosomal Location4401915-4432388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4427466 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 71 (M71K)
Ref Sequence ENSEMBL: ENSMUSP00000119033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042251] [ENSMUST00000126102] [ENSMUST00000131853] [ENSMUST00000155172]
Predicted Effect probably benign
Transcript: ENSMUST00000042251
AA Change: M71K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043355
Gene: ENSMUSG00000019763
AA Change: M71K

DomainStartEndE-ValueType
Pfam:DUF155 227 404 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126102
AA Change: M71K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000131853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148566
Predicted Effect probably benign
Transcript: ENSMUST00000155172
AA Change: M71K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156940
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved sif2 family of proteins that share the DUF155 domain in common. This protein is thought to be localized in the mitochondria and involved in mitochondrial translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-11. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Rmnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Rmnd1 APN 10 4427392 missense probably benign
IGL01018:Rmnd1 APN 10 4427290 missense probably benign 0.43
IGL01112:Rmnd1 APN 10 4410793 unclassified probably null
R0418:Rmnd1 UTSW 10 4427693 critical splice acceptor site probably null
R2036:Rmnd1 UTSW 10 4407884 missense probably damaging 1.00
R2319:Rmnd1 UTSW 10 4422099 missense possibly damaging 0.62
R4191:Rmnd1 UTSW 10 4410809 unclassified probably benign
R5077:Rmnd1 UTSW 10 4427488 missense possibly damaging 0.66
R5620:Rmnd1 UTSW 10 4422159 missense probably damaging 1.00
R5659:Rmnd1 UTSW 10 4427382 missense probably benign 0.04
R6291:Rmnd1 UTSW 10 4422135 missense probably damaging 1.00
R7089:Rmnd1 UTSW 10 4403873 missense probably damaging 1.00
R7214:Rmnd1 UTSW 10 4410753 missense probably benign
X0026:Rmnd1 UTSW 10 4427676 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- GATGAGTGATGCCTCTTTACTGC -3'
(R):5'- AAGATGCGACCATGCCATCC -3'

Sequencing Primer
(F):5'- GATGCCTCTTTACTGCTTTTATAAAC -3'
(R):5'- CTGGCAAGTTTACACAGCATATCAG -3'
Posted On2014-11-11