Incidental Mutation 'R2312:Rhobtb1'
ID247351
Institutional Source Beutler Lab
Gene Symbol Rhobtb1
Ensembl Gene ENSMUSG00000019944
Gene NameRho-related BTB domain containing 1
Synonyms
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location69151434-69291791 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 69270463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 286 (S286*)
Ref Sequence ENSEMBL: ENSMUSP00000131222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020101] [ENSMUST00000067908] [ENSMUST00000163497] [ENSMUST00000164034] [ENSMUST00000167384] [ENSMUST00000168117]
Predicted Effect probably null
Transcript: ENSMUST00000020101
AA Change: S348*
SMART Domains Protein: ENSMUSP00000020101
Gene: ENSMUSG00000019944
AA Change: S348*

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067908
AA Change: S348*
SMART Domains Protein: ENSMUSP00000065095
Gene: ENSMUSG00000019944
AA Change: S348*

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163497
SMART Domains Protein: ENSMUSP00000129119
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
Pfam:Ras 16 96 1.8e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164034
AA Change: S348*
SMART Domains Protein: ENSMUSP00000132068
Gene: ENSMUSG00000019944
AA Change: S348*

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164876
Predicted Effect probably null
Transcript: ENSMUST00000167384
AA Change: S286*
SMART Domains Protein: ENSMUSP00000131222
Gene: ENSMUSG00000019944
AA Change: S286*

DomainStartEndE-ValueType
PDB:3RYT|C 10 97 8e-6 PDB
SCOP:d1ky3a_ 15 150 8e-16 SMART
Blast:RHO 17 99 5e-50 BLAST
low complexity region 163 184 N/A INTRINSIC
BTB 204 394 6.29e-13 SMART
BTB 422 520 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168117
SMART Domains Protein: ENSMUSP00000131509
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
Pfam:Ras 16 97 1.9e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169569
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Rho family of the small GTPase superfamily. It contains a GTPase domain, a proline-rich region, a tandem of 2 BTB (broad complex, tramtrack, and bric-a-brac) domains, and a conserved C-terminal region. The protein plays a role in small GTPase-mediated signal transduction and the organization of the actin filament system. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Rhobtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Rhobtb1 APN 10 69270221 missense probably damaging 1.00
IGL01504:Rhobtb1 APN 10 69249698 missense probably damaging 1.00
IGL01561:Rhobtb1 APN 10 69270391 missense probably benign 0.17
IGL01924:Rhobtb1 APN 10 69270304 missense probably damaging 1.00
IGL02252:Rhobtb1 APN 10 69249685 missense probably damaging 1.00
IGL02334:Rhobtb1 APN 10 69285678 splice site probably benign
IGL02393:Rhobtb1 APN 10 69288987 missense probably damaging 1.00
IGL02514:Rhobtb1 APN 10 69289641 missense probably benign 0.00
IGL03192:Rhobtb1 APN 10 69248823 missense probably damaging 1.00
R1687:Rhobtb1 UTSW 10 69270279 missense probably damaging 1.00
R1713:Rhobtb1 UTSW 10 69272771 missense probably benign 0.05
R1713:Rhobtb1 UTSW 10 69272772 missense possibly damaging 0.61
R1750:Rhobtb1 UTSW 10 69279406 missense probably damaging 1.00
R2044:Rhobtb1 UTSW 10 69272863 splice site probably benign
R2402:Rhobtb1 UTSW 10 69270424 missense probably benign 0.00
R3815:Rhobtb1 UTSW 10 69285693 missense possibly damaging 0.75
R4633:Rhobtb1 UTSW 10 69249613 splice site probably null
R4737:Rhobtb1 UTSW 10 69279497 critical splice donor site probably null
R4780:Rhobtb1 UTSW 10 69270153 missense probably benign 0.02
R4865:Rhobtb1 UTSW 10 69270724 missense probably benign 0.04
R5124:Rhobtb1 UTSW 10 69269901 critical splice acceptor site probably null
R5248:Rhobtb1 UTSW 10 69248785 missense probably damaging 1.00
R5304:Rhobtb1 UTSW 10 69269912 missense probably damaging 1.00
R5480:Rhobtb1 UTSW 10 69270733 missense possibly damaging 0.86
R5836:Rhobtb1 UTSW 10 69269989 missense probably damaging 1.00
R5951:Rhobtb1 UTSW 10 69270255 missense probably damaging 0.99
R6218:Rhobtb1 UTSW 10 69270456 missense probably benign 0.00
R6629:Rhobtb1 UTSW 10 69270316 missense possibly damaging 0.92
R6869:Rhobtb1 UTSW 10 69270226 missense probably damaging 0.99
R7081:Rhobtb1 UTSW 10 69266297 missense probably benign 0.29
R7260:Rhobtb1 UTSW 10 69270780 nonsense probably null
R7427:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R7428:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGACGAGGAGCACATCTTTG -3'
(R):5'- GTAGAGGAATCTCAGCAGGGTC -3'

Sequencing Primer
(F):5'- GCACATCTTTGCGCACCG -3'
(R):5'- AAAGGGCCTGACTGCATC -3'
Posted On2014-11-11