Incidental Mutation 'R2312:Prmt2'
ID247352
Institutional Source Beutler Lab
Gene Symbol Prmt2
Ensembl Gene ENSMUSG00000020230
Gene Nameprotein arginine N-methyltransferase 2
SynonymsHrmt1l1
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score151
Status Not validated
Chromosome10
Chromosomal Location76207222-76237865 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 76226255 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 39 (Q39*)
Ref Sequence ENSEMBL: ENSMUSP00000151456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020452] [ENSMUST00000099571] [ENSMUST00000099572] [ENSMUST00000128099] [ENSMUST00000137857] [ENSMUST00000217726]
Predicted Effect probably null
Transcript: ENSMUST00000020452
AA Change: Q39*
SMART Domains Protein: ENSMUSP00000020452
Gene: ENSMUSG00000020230
AA Change: Q39*

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099571
AA Change: Q39*
SMART Domains Protein: ENSMUSP00000097166
Gene: ENSMUSG00000020230
AA Change: Q39*

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099572
AA Change: Q39*
SMART Domains Protein: ENSMUSP00000097167
Gene: ENSMUSG00000020230
AA Change: Q39*

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 124 253 3.1e-8 PFAM
Pfam:PRMT5 124 451 1.2e-11 PFAM
Pfam:MTS 137 223 3.3e-10 PFAM
Pfam:Methyltransf_31 147 294 1.7e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128099
AA Change: Q39*
SMART Domains Protein: ENSMUSP00000137707
Gene: ENSMUSG00000020230
AA Change: Q39*

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.3e-9 PFAM
Pfam:Met_10 122 235 3.8e-8 PFAM
Pfam:TehB 122 235 6.9e-8 PFAM
Pfam:MTS 133 223 2e-11 PFAM
Pfam:Methyltransf_31 147 243 9.3e-9 PFAM
Pfam:Methyltransf_26 150 224 4.6e-10 PFAM
Pfam:Methyltransf_11 154 238 3.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137857
AA Change: Q39*
SMART Domains Protein: ENSMUSP00000137725
Gene: ENSMUSG00000020230
AA Change: Q39*

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.5e-9 PFAM
Pfam:Met_10 129 235 4.2e-7 PFAM
Pfam:MTS 137 223 1.1e-10 PFAM
Pfam:Methyltransf_31 147 243 9.2e-9 PFAM
Pfam:Methyltransf_11 154 237 1.7e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217726
AA Change: Q39*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a hyperplastic response to vascular injury while mutant mouse embryonic fibroblasts show an earlier S phase entry following release of serum starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Prmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Prmt2 APN 10 76222493 missense probably damaging 1.00
IGL01663:Prmt2 APN 10 76217309 splice site probably null
IGL02015:Prmt2 APN 10 76226255 nonsense probably null
IGL03094:Prmt2 APN 10 76210390 splice site probably benign
R0352:Prmt2 UTSW 10 76208503 missense possibly damaging 0.89
R0617:Prmt2 UTSW 10 76208683 intron probably benign
R0831:Prmt2 UTSW 10 76207807 unclassified probably benign
R0885:Prmt2 UTSW 10 76222565 missense probably damaging 1.00
R1882:Prmt2 UTSW 10 76222468 missense probably benign 0.00
R2022:Prmt2 UTSW 10 76225458 nonsense probably null
R2401:Prmt2 UTSW 10 76225415 nonsense probably null
R2408:Prmt2 UTSW 10 76208467 missense probably damaging 0.98
R3753:Prmt2 UTSW 10 76225303 missense probably benign 0.01
R4707:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4785:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4937:Prmt2 UTSW 10 76221008 missense probably damaging 1.00
R5072:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5073:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5074:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5851:Prmt2 UTSW 10 76236740 missense possibly damaging 0.61
R6084:Prmt2 UTSW 10 76210444 missense probably benign 0.23
R6120:Prmt2 UTSW 10 76209446 missense possibly damaging 0.51
R6239:Prmt2 UTSW 10 76222591 nonsense probably null
R6317:Prmt2 UTSW 10 76222517 missense probably benign 0.15
R6659:Prmt2 UTSW 10 76217374 missense possibly damaging 0.85
R7174:Prmt2 UTSW 10 76225339 missense probably benign 0.00
R7421:Prmt2 UTSW 10 76221078 missense probably benign 0.00
R7485:Prmt2 UTSW 10 76221004 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGGCATCTCTATATCCTGATG -3'
(R):5'- GCCCTAAGGATGCTAGTGAAGG -3'

Sequencing Primer
(F):5'- CATCTCTATATCCTGATGGGGAAGTC -3'
(R):5'- CTAAGGATGCTAGTGAAGGTGGCTC -3'
Posted On2014-11-11