Incidental Mutation 'R2312:Uhrf1bp1l'
ID247354
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1l
Ensembl Gene ENSMUSG00000019951
Gene NameUHRF1 (ICBP90) binding protein 1-like
Synonyms4930506D01Rik, E030041M21Rik, 2010319N22Rik
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89744991-89819871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89781133 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000020112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020112] [ENSMUST00000219712] [ENSMUST00000220375]
Predicted Effect probably damaging
Transcript: ENSMUST00000020112
AA Change: T179A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020112
Gene: ENSMUSG00000019951
AA Change: T179A

DomainStartEndE-ValueType
Pfam:Chorein_N 1 103 9.3e-21 PFAM
SCOP:d1c52__ 243 304 5e-3 SMART
low complexity region 788 801 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
coiled coil region 1410 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219712
Predicted Effect possibly damaging
Transcript: ENSMUST00000220375
AA Change: T91A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Uhrf1bp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Uhrf1bp1l APN 10 89779984 missense probably damaging 1.00
IGL01102:Uhrf1bp1l APN 10 89791378 missense probably benign 0.00
IGL01457:Uhrf1bp1l APN 10 89805762 missense probably benign 0.06
IGL01647:Uhrf1bp1l APN 10 89774120 critical splice donor site probably null
IGL02552:Uhrf1bp1l APN 10 89806743 nonsense probably null
IGL02686:Uhrf1bp1l APN 10 89805193 missense probably benign
R0019:Uhrf1bp1l UTSW 10 89775969 missense probably damaging 1.00
R0505:Uhrf1bp1l UTSW 10 89791443 missense probably damaging 1.00
R0746:Uhrf1bp1l UTSW 10 89805454 missense probably benign 0.37
R1255:Uhrf1bp1l UTSW 10 89745270 missense probably damaging 0.98
R1385:Uhrf1bp1l UTSW 10 89790641 missense possibly damaging 0.92
R1720:Uhrf1bp1l UTSW 10 89782586 missense probably damaging 1.00
R2142:Uhrf1bp1l UTSW 10 89812048 missense probably damaging 1.00
R2986:Uhrf1bp1l UTSW 10 89806069 missense probably benign 0.00
R4063:Uhrf1bp1l UTSW 10 89816055 missense probably benign 0.38
R4278:Uhrf1bp1l UTSW 10 89806709 unclassified probably null
R4854:Uhrf1bp1l UTSW 10 89794484 missense probably damaging 1.00
R4857:Uhrf1bp1l UTSW 10 89779963 missense probably damaging 0.97
R5135:Uhrf1bp1l UTSW 10 89789355 missense probably damaging 1.00
R5467:Uhrf1bp1l UTSW 10 89805099 missense probably damaging 1.00
R5567:Uhrf1bp1l UTSW 10 89808521 missense probably benign 0.18
R5767:Uhrf1bp1l UTSW 10 89787199 missense possibly damaging 0.68
R6191:Uhrf1bp1l UTSW 10 89805318 missense possibly damaging 0.78
R6196:Uhrf1bp1l UTSW 10 89805333 missense probably benign 0.00
R6387:Uhrf1bp1l UTSW 10 89803057 nonsense probably null
R6729:Uhrf1bp1l UTSW 10 89805684 missense probably benign 0.01
R6746:Uhrf1bp1l UTSW 10 89787158 missense probably benign 0.19
R6794:Uhrf1bp1l UTSW 10 89805762 missense probably benign 0.06
R6892:Uhrf1bp1l UTSW 10 89805123 missense probably benign 0.02
R6990:Uhrf1bp1l UTSW 10 89806117 missense probably benign 0.12
R7188:Uhrf1bp1l UTSW 10 89779882 missense probably damaging 0.96
R7226:Uhrf1bp1l UTSW 10 89808641 missense probably benign 0.00
R7376:Uhrf1bp1l UTSW 10 89809656 missense probably damaging 1.00
X0060:Uhrf1bp1l UTSW 10 89805379 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTACAGATGAGGGCGATTCTG -3'
(R):5'- CCTGCCAACACTGTCTGAAC -3'

Sequencing Primer
(F):5'- TACAGATGAGGGCGATTCTGAATGTG -3'
(R):5'- TGTCTGAACAGGGCACAC -3'
Posted On2014-11-11