Incidental Mutation 'R2312:Rnf130'
ID247358
Institutional Source Beutler Lab
Gene Symbol Rnf130
Ensembl Gene ENSMUSG00000020376
Gene Namering finger protein 130
SynonymsG1RZFP, G1RP, 2510042A13Rik
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50025346-50104758 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 50087463 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054684] [ENSMUST00000102776]
Predicted Effect probably null
Transcript: ENSMUST00000054684
SMART Domains Protein: ENSMUSP00000056345
Gene: ENSMUSG00000020376

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 65 169 4.6e-13 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102776
SMART Domains Protein: ENSMUSP00000099837
Gene: ENSMUSG00000020376

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 69 167 8.1e-14 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Rnf130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Rnf130 APN 11 50093796 missense probably damaging 1.00
IGL02364:Rnf130 APN 11 50095840 missense probably benign
IGL02948:Rnf130 APN 11 50052771 splice site probably benign
R0145:Rnf130 UTSW 11 50071219 missense possibly damaging 0.89
R0358:Rnf130 UTSW 11 50071282 missense probably benign 0.01
R0570:Rnf130 UTSW 11 50095876 missense possibly damaging 0.66
R0786:Rnf130 UTSW 11 50087437 missense probably damaging 1.00
R1709:Rnf130 UTSW 11 50087386 missense possibly damaging 0.80
R2972:Rnf130 UTSW 11 50093800 nonsense probably null
R4353:Rnf130 UTSW 11 50087440 missense possibly damaging 0.83
R4398:Rnf130 UTSW 11 50071378 missense probably benign 0.08
R5162:Rnf130 UTSW 11 50052895 missense probably damaging 1.00
R5236:Rnf130 UTSW 11 50095978 missense probably damaging 0.99
R5869:Rnf130 UTSW 11 50085815 splice site probably null
R6432:Rnf130 UTSW 11 50095790 nonsense probably null
R6865:Rnf130 UTSW 11 50071264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGCTCATGGTAGAGTGTTC -3'
(R):5'- AGGGTTACTGAATACAGACTCTTAG -3'

Sequencing Primer
(F):5'- CTGCTCATGGTAGAGTGTTCTTAGC -3'
(R):5'- ATATGCCTCAATGTTGTCATGTTTTC -3'
Posted On2014-11-11