Incidental Mutation 'R2312:Ptgdr'
ID247366
Institutional Source Beutler Lab
Gene Symbol Ptgdr
Ensembl Gene ENSMUSG00000071489
Gene Nameprostaglandin D receptor
SynonymsDP
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location44851235-44859375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44859162 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 31 (L31R)
Ref Sequence ENSEMBL: ENSMUSP00000093653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095959]
Predicted Effect probably damaging
Transcript: ENSMUST00000095959
AA Change: L31R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093653
Gene: ENSMUSG00000071489
AA Change: L31R

DomainStartEndE-ValueType
low complexity region 22 46 N/A INTRINSIC
Pfam:7tm_1 54 319 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227507
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein is reported to be a receptor for prostaglandin D2, which is a mediator of allergic inflammation and allergic airway inflammation in asthma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduced inflammatory response to airborn allergens and reduced susceptibility to passive cutaneous anaphylaxis induced by IgE antigen challenge due to impaired mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Ptgdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Ptgdr APN 14 44858614 missense probably damaging 1.00
R1036:Ptgdr UTSW 14 44859115 missense probably damaging 0.98
R1368:Ptgdr UTSW 14 44853342 missense probably damaging 1.00
R1649:Ptgdr UTSW 14 44858502 missense probably benign
R1785:Ptgdr UTSW 14 44858579 nonsense probably null
R1786:Ptgdr UTSW 14 44858579 nonsense probably null
R1921:Ptgdr UTSW 14 44853281 missense probably benign 0.00
R4867:Ptgdr UTSW 14 44858796 missense probably damaging 1.00
R5198:Ptgdr UTSW 14 44858843 missense probably damaging 1.00
R6917:Ptgdr UTSW 14 44858610 missense possibly damaging 0.81
R7186:Ptgdr UTSW 14 44858944 missense probably damaging 1.00
R7291:Ptgdr UTSW 14 44859192 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCGCATAACTGATTGCCTGAGG -3'
(R):5'- AACCTCTGTGCCTTAGCTGC -3'

Sequencing Primer
(F):5'- AGGCAGCAGTTCCTTTAGGCTC -3'
(R):5'- TTAGCTGCGCCCTGAGC -3'
Posted On2014-11-11