Incidental Mutation 'R2312:Fbln1'
ID247368
Institutional Source Beutler Lab
Gene Symbol Fbln1
Ensembl Gene ENSMUSG00000006369
Gene Namefibulin 1
Synonyms
MMRRC Submission 040311-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85205949-85286535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85263348 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 598 (V598A)
Ref Sequence ENSEMBL: ENSMUSP00000054583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057410]
Predicted Effect probably benign
Transcript: ENSMUST00000057410
AA Change: V598A

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054583
Gene: ENSMUSG00000006369
AA Change: V598A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF 530 580 1.25e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160798
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene develop problems with spontaneous bleeding as embryos. Most die within the first two days of life. Those that survive this period develop normally and eventually recover from their early developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Gldc A T 19: 30,100,826 F924I probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Fbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Fbln1 APN 15 85227037 missense probably benign 0.00
IGL01017:Fbln1 APN 15 85244189 missense possibly damaging 0.94
IGL02514:Fbln1 APN 15 85244262 nonsense probably null
IGL02693:Fbln1 APN 15 85229574 missense probably benign 0.00
IGL02734:Fbln1 APN 15 85226981 missense probably damaging 1.00
IGL02964:Fbln1 APN 15 85231462 missense probably damaging 1.00
IGL03176:Fbln1 APN 15 85244306 missense possibly damaging 0.69
IGL03274:Fbln1 APN 15 85232678 critical splice donor site probably null
R0090:Fbln1 UTSW 15 85224288 missense possibly damaging 0.94
R0148:Fbln1 UTSW 15 85230826 missense probably damaging 0.97
R0393:Fbln1 UTSW 15 85227076 missense probably damaging 0.99
R0564:Fbln1 UTSW 15 85227107 missense probably benign 0.07
R1276:Fbln1 UTSW 15 85229590 missense probably damaging 1.00
R1592:Fbln1 UTSW 15 85231464 missense probably benign 0.00
R1687:Fbln1 UTSW 15 85227106 missense probably benign 0.02
R2363:Fbln1 UTSW 15 85227140 critical splice donor site probably null
R3082:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3083:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3751:Fbln1 UTSW 15 85227078 nonsense probably null
R3752:Fbln1 UTSW 15 85227078 nonsense probably null
R3753:Fbln1 UTSW 15 85227078 nonsense probably null
R4028:Fbln1 UTSW 15 85227116 missense probably benign 0.05
R4406:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4407:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4408:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4612:Fbln1 UTSW 15 85238559 missense probably benign 0.00
R4811:Fbln1 UTSW 15 85226966 critical splice acceptor site probably null
R5022:Fbln1 UTSW 15 85237626 missense probably damaging 0.99
R5121:Fbln1 UTSW 15 85237671 missense probably damaging 1.00
R7285:Fbln1 UTSW 15 85237628 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGTTTAGCCTGGCCAC -3'
(R):5'- AAGATGTGCATCCTACCCCG -3'

Sequencing Primer
(F):5'- TAGGTGCTGATAGAAGTGCCCC -3'
(R):5'- GTGCATCCTACCCCGACCAC -3'
Posted On2014-11-11