Incidental Mutation 'R2312:Gldc'
ID247376
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 040311-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2312 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30100826 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 924 (F924I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: F924I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: F924I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp12 A G 1: 93,006,809 E136G probably benign Het
Cdhr4 G A 9: 107,995,287 V244I probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crygf A T 1: 65,926,558 M1L probably benign Het
Dapk1 G T 13: 60,757,353 C959F probably damaging Het
Dopey1 C G 9: 86,521,442 S1565* probably null Het
Eya4 A G 10: 23,106,264 S622P probably damaging Het
Fbln1 T C 15: 85,263,348 V598A probably benign Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Herc1 C A 9: 66,508,281 S4846* probably null Het
Jmjd1c A T 10: 67,238,850 K1917N probably damaging Het
Kcnh2 A G 5: 24,324,954 probably null Het
Lmtk2 T C 5: 144,173,626 F388S probably damaging Het
Lpar1 A C 4: 58,487,168 Y34* probably null Het
Lrpprc G A 17: 84,773,258 P180S probably damaging Het
Mex3a A G 3: 88,536,478 H287R probably damaging Het
Nid1 A G 13: 13,500,493 T933A probably benign Het
Olfr584 A G 7: 103,086,426 T298A probably damaging Het
Pcdhb7 A G 18: 37,342,197 T129A probably benign Het
Pfkm T A 15: 98,125,575 Y385N probably damaging Het
Prmt2 G A 10: 76,226,255 Q39* probably null Het
Prx T C 7: 27,516,626 V184A possibly damaging Het
Ptgdr A C 14: 44,859,162 L31R probably damaging Het
Rab3b A G 4: 108,890,494 T63A probably damaging Het
Rassf1 T C 9: 107,557,550 M156T probably damaging Het
Rhobtb1 C A 10: 69,270,463 S286* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rmnd1 A T 10: 4,427,466 M71K probably benign Het
Rnf130 T A 11: 50,087,463 probably null Het
Rxrb T A 17: 34,032,129 probably benign Het
Ryr2 G T 13: 11,738,242 T1731K probably damaging Het
Serpine2 A T 1: 79,802,853 L293Q probably damaging Het
Skint6 T C 4: 113,238,142 T107A probably damaging Het
Slc9a8 T A 2: 167,451,276 H181Q probably benign Het
Spaca3 A T 11: 80,863,211 Y58F possibly damaging Het
Sptbn1 T C 11: 30,154,249 T152A probably damaging Het
Tlr2 A G 3: 83,837,540 L412P probably damaging Het
Trak2 A G 1: 58,935,782 S84P probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm2 C A 10: 77,918,964 E1229D probably benign Het
Ttc14 A G 3: 33,807,835 probably null Het
Tyrp1 G A 4: 80,837,564 W190* probably null Het
Uhrf1bp1l A G 10: 89,781,133 T179A probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vegfb C A 19: 6,985,427 R160L possibly damaging Het
Vmn1r220 A G 13: 23,183,977 M183T probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt10a C A 1: 74,803,430 A355E possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CAGCCATTCGAGATTGAAACCTC -3'
(R):5'- TCCTGCTACTACATAGACGTACC -3'

Sequencing Primer
(F):5'- CGAGATTGAAACCTCTGTGTTTC -3'
(R):5'- CGTACCTTAGAATGCTTGTAAAAGCC -3'
Posted On2014-11-11