Incidental Mutation 'R2357:Eps8l1'
ID247433
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2357 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4470355 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 179 (S179P)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably benign
Transcript: ENSMUST00000086372
AA Change: S118P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: S118P

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably benign
Transcript: ENSMUST00000163893
AA Change: S118P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: S118P

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167068
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably benign
Transcript: ENSMUST00000167810
AA Change: S118P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154
AA Change: S118P

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169820
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171445
AA Change: S179P

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: S179P

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTGGCAAGCTATCCTTTGAAGC -3'
(R):5'- CTATGTCCCCGTTTGCCAAG -3'

Sequencing Primer
(F):5'- GCAAGCTATCCTTTGAAGCCTAGG -3'
(R):5'- CCGTTTGCCAAGGCCCC -3'
Posted On2014-11-11