Incidental Mutation 'R2357:Kptn'
ID247435
Institutional Source Beutler Lab
Gene Symbol Kptn
Ensembl Gene ENSMUSG00000006021
Gene Namekaptin
Synonymsactin-binding protein, C030013F01Rik, 2E4, 2310042D10Rik
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2357 (G1)
Quality Score189
Status Validated
Chromosome7
Chromosomal Location16119895-16127516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16125784 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 311 (C311F)
Ref Sequence ENSEMBL: ENSMUSP00000006178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006178] [ENSMUST00000168693] [ENSMUST00000211649]
Predicted Effect probably damaging
Transcript: ENSMUST00000006178
AA Change: C311F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006178
Gene: ENSMUSG00000006021
AA Change: C311F

DomainStartEndE-ValueType
low complexity region 288 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152044
Predicted Effect probably benign
Transcript: ENSMUST00000168693
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211649
Meta Mutation Damage Score 0.842 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous-actin-associated protein, which is involved in actin dynamics and plays an important role in neuromorphogenesis. Mutations in this gene result in recessive mental retardation-41. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight, increased susceptibility to bacterial infection and abnormal homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Kptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Kptn APN 7 16120125 missense possibly damaging 0.93
IGL01844:Kptn APN 7 16123972 missense probably benign 0.05
IGL01938:Kptn APN 7 16124789 missense probably damaging 1.00
IGL02268:Kptn APN 7 16123861 missense probably benign 0.03
IGL02382:Kptn APN 7 16124020 missense probably benign 0.00
IGL02399:Kptn APN 7 16127113 unclassified probably benign
IGL03237:Kptn APN 7 16120125 missense probably damaging 0.97
captain UTSW 7 16125784 missense probably damaging 1.00
commander UTSW 7 16125785 nonsense probably null
mate UTSW 7 16123103 missense probably damaging 1.00
PIT4687001:Kptn UTSW 7 16125826 missense probably damaging 0.96
R0344:Kptn UTSW 7 16125741 missense probably damaging 1.00
R0726:Kptn UTSW 7 16120722 missense probably damaging 0.99
R1421:Kptn UTSW 7 16123024 splice site probably benign
R1545:Kptn UTSW 7 16123963 missense probably benign 0.12
R5068:Kptn UTSW 7 16123102 missense probably damaging 1.00
R5127:Kptn UTSW 7 16125785 nonsense probably null
R5195:Kptn UTSW 7 16123103 missense probably damaging 1.00
R5714:Kptn UTSW 7 16120758 unclassified probably null
R7121:Kptn UTSW 7 16123098 missense probably damaging 1.00
Z1088:Kptn UTSW 7 16123070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGATGAACACTCGAGGC -3'
(R):5'- TATAGCAGAGCAGCTCCTGTGG -3'

Sequencing Primer
(F):5'- TCAGGAGTGAGTCTGGACCTCAG -3'
(R):5'- TCCTGTGGGGAGAGGGGC -3'
Posted On2014-11-11