Incidental Mutation 'R2371:Pigc'
ID247517
Institutional Source Beutler Lab
Gene Symbol Pigc
Ensembl Gene ENSMUSG00000026698
Gene Namephosphatidylinositol glycan anchor biosynthesis, class C
Synonyms3110030E07Rik
MMRRC Submission 040351-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2371 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161969186-161973435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 161971010 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000141646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028021] [ENSMUST00000111594] [ENSMUST00000159648] [ENSMUST00000160881] [ENSMUST00000162676] [ENSMUST00000193784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028021
AA Change: V187A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028021
Gene: ENSMUSG00000026698
AA Change: V187A

DomainStartEndE-ValueType
Pfam:GPI2 14 284 6.2e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111594
AA Change: V187A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107221
Gene: ENSMUSG00000026698
AA Change: V187A

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141397
Predicted Effect probably benign
Transcript: ENSMUST00000159648
Predicted Effect probably benign
Transcript: ENSMUST00000160881
SMART Domains Protein: ENSMUSP00000125321
Gene: ENSMUSG00000026698

DomainStartEndE-ValueType
Pfam:GPI2 14 140 2.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161826
Predicted Effect probably benign
Transcript: ENSMUST00000162676
SMART Domains Protein: ENSMUSP00000124751
Gene: ENSMUSG00000086277

DomainStartEndE-ValueType
Pfam:DUF4548 17 181 1.9e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193784
AA Change: V187A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141646
Gene: ENSMUSG00000026698
AA Change: V187A

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Adamts18 T A 8: 113,705,261 E1105V probably benign Het
Colec10 A G 15: 54,462,400 I209V possibly damaging Het
Cttnbp2 T G 6: 18,380,604 S1422R possibly damaging Het
Dcst1 C G 3: 89,358,642 V179L possibly damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fgl2 A T 5: 21,375,818 Y386F probably damaging Het
Gabrb2 A G 11: 42,591,864 Y183C probably damaging Het
Hlcs A G 16: 94,268,067 L245P probably damaging Het
Hormad1 T A 3: 95,575,599 I132K probably benign Het
Itga8 A T 2: 12,253,466 D262E probably damaging Het
Jhy G A 9: 40,917,482 T376I probably benign Het
Kidins220 T C 12: 25,057,324 L1592P probably damaging Het
Kif3b T C 2: 153,322,823 I587T possibly damaging Het
Lrrc7 A G 3: 158,161,060 Y1015H probably damaging Het
Lvrn T G 18: 46,878,163 probably null Het
Mapkbp1 C A 2: 120,010,780 Q83K probably damaging Het
Olfr117 T C 17: 37,660,153 Y60C probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Ros1 A T 10: 52,163,895 H333Q possibly damaging Het
Rreb1 T C 13: 37,916,537 F215L probably benign Het
Rtcb C T 10: 85,943,833 M324I probably benign Het
Senp2 A G 16: 22,018,375 I125V possibly damaging Het
Shroom3 A G 5: 92,780,870 K95E probably damaging Het
Wrnip1 C T 13: 32,802,427 P64S probably benign Het
Zbtb24 C T 10: 41,451,268 A50V probably damaging Het
Other mutations in Pigc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01725:Pigc APN 1 161971345 utr 3 prime probably benign
IGL02009:Pigc APN 1 161970565 missense probably damaging 1.00
IGL02586:Pigc APN 1 161970934 missense probably benign 0.02
IGL03095:Pigc APN 1 161970776 missense possibly damaging 0.79
IGL03109:Pigc APN 1 161970776 missense possibly damaging 0.79
apocryphon UTSW 1 161971094 missense probably benign 0.21
pistis UTSW 1 161970947 missense probably damaging 0.99
R0321:Pigc UTSW 1 161971099 nonsense probably null
R1450:Pigc UTSW 1 161971253 missense probably benign 0.01
R1708:Pigc UTSW 1 161970724 missense probably benign 0.00
R1857:Pigc UTSW 1 161970877 missense possibly damaging 0.90
R1875:Pigc UTSW 1 161970947 missense probably damaging 0.99
R2940:Pigc UTSW 1 161970670 missense possibly damaging 0.96
R3706:Pigc UTSW 1 161971094 missense probably benign 0.21
R3707:Pigc UTSW 1 161971094 missense probably benign 0.21
R3708:Pigc UTSW 1 161971094 missense probably benign 0.21
R3725:Pigc UTSW 1 161971291 missense possibly damaging 0.95
R5193:Pigc UTSW 1 161970896 missense possibly damaging 0.91
R5682:Pigc UTSW 1 161970947 missense probably damaging 0.99
R6228:Pigc UTSW 1 161970467 missense probably benign 0.03
R7143:Pigc UTSW 1 161970592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACCTGAAGAGTACTCTGGTC -3'
(R):5'- GCAAAGAGTATGGCTCCCACAG -3'

Sequencing Primer
(F):5'- ACCTGAAGAGTACTCTGGTCTTTATC -3'
(R):5'- GCACTAATGGACAGAAGACCTC -3'
Posted On2014-11-11