Incidental Mutation 'R2371:Dcst1'
ID247521
Institutional Source Beutler Lab
Gene Symbol Dcst1
Ensembl Gene ENSMUSG00000042672
Gene NameDC-STAMP domain containing 1
Synonyms
MMRRC Submission 040351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2371 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89350219-89365253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89358642 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 179 (V179L)
Ref Sequence ENSEMBL: ENSMUSP00000065502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070820] [ENSMUST00000208216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070820
AA Change: V179L

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672
AA Change: V179L

DomainStartEndE-ValueType
coiled coil region 18 44 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 108 125 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
Pfam:DC_STAMP 431 621 1.5e-55 PFAM
Blast:RING 672 710 3e-17 BLAST
SCOP:d1ldjb_ 672 710 2e-3 SMART
low complexity region 717 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200174
Predicted Effect probably benign
Transcript: ENSMUST00000208216
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein. A similar gene in human has been associated with dendritic cells. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Adamts18 T A 8: 113,705,261 E1105V probably benign Het
Colec10 A G 15: 54,462,400 I209V possibly damaging Het
Cttnbp2 T G 6: 18,380,604 S1422R possibly damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fgl2 A T 5: 21,375,818 Y386F probably damaging Het
Gabrb2 A G 11: 42,591,864 Y183C probably damaging Het
Hlcs A G 16: 94,268,067 L245P probably damaging Het
Hormad1 T A 3: 95,575,599 I132K probably benign Het
Itga8 A T 2: 12,253,466 D262E probably damaging Het
Jhy G A 9: 40,917,482 T376I probably benign Het
Kidins220 T C 12: 25,057,324 L1592P probably damaging Het
Kif3b T C 2: 153,322,823 I587T possibly damaging Het
Lrrc7 A G 3: 158,161,060 Y1015H probably damaging Het
Lvrn T G 18: 46,878,163 probably null Het
Mapkbp1 C A 2: 120,010,780 Q83K probably damaging Het
Olfr117 T C 17: 37,660,153 Y60C probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Pigc T C 1: 161,971,010 V187A possibly damaging Het
Ros1 A T 10: 52,163,895 H333Q possibly damaging Het
Rreb1 T C 13: 37,916,537 F215L probably benign Het
Rtcb C T 10: 85,943,833 M324I probably benign Het
Senp2 A G 16: 22,018,375 I125V possibly damaging Het
Shroom3 A G 5: 92,780,870 K95E probably damaging Het
Wrnip1 C T 13: 32,802,427 P64S probably benign Het
Zbtb24 C T 10: 41,451,268 A50V probably damaging Het
Other mutations in Dcst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02373:Dcst1 APN 3 89357891 missense probably damaging 0.98
R0722:Dcst1 UTSW 3 89353805 missense probably benign 0.04
R0782:Dcst1 UTSW 3 89357500 missense possibly damaging 0.88
R0891:Dcst1 UTSW 3 89353277 missense probably benign 0.16
R1434:Dcst1 UTSW 3 89352519 missense probably damaging 1.00
R1807:Dcst1 UTSW 3 89353541 missense probably damaging 1.00
R1831:Dcst1 UTSW 3 89352750 missense probably damaging 0.98
R2129:Dcst1 UTSW 3 89357545 missense probably damaging 0.97
R4600:Dcst1 UTSW 3 89356336 missense probably benign 0.01
R4761:Dcst1 UTSW 3 89357553 missense possibly damaging 0.83
R4906:Dcst1 UTSW 3 89350507 missense possibly damaging 0.85
R4974:Dcst1 UTSW 3 89357803 missense probably benign 0.27
R5552:Dcst1 UTSW 3 89365066 missense probably benign 0.03
R5910:Dcst1 UTSW 3 89350424 missense possibly damaging 0.94
R5943:Dcst1 UTSW 3 89356411 splice site probably null
R5992:Dcst1 UTSW 3 89352576 missense probably damaging 1.00
R6630:Dcst1 UTSW 3 89364326 missense possibly damaging 0.75
R6685:Dcst1 UTSW 3 89356873 missense possibly damaging 0.49
R6877:Dcst1 UTSW 3 89350360 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAAAGGCTCTGCAATGTCTGGG -3'
(R):5'- TCATTATGGAGGCCCAGAAGG -3'

Sequencing Primer
(F):5'- CTGCAATGTCTGGGGATAGTGATAC -3'
(R):5'- CCCAGAAGGTGGCCTAATGTCTAG -3'
Posted On2014-11-11