Incidental Mutation 'R2371:Kidins220'
ID 247536
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Name kinase D-interacting substrate 220
Synonyms C330002I19Rik, 3110039L19Rik
MMRRC Submission 040351-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2371 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 25024924-25113151 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25107323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1592 (L1592P)
Ref Sequence ENSEMBL: ENSMUSP00000152683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
AlphaFold E9Q9B7
Predicted Effect probably damaging
Transcript: ENSMUST00000066652
AA Change: L1622P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: L1622P

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220459
AA Change: L1501P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221622
Predicted Effect probably benign
Transcript: ENSMUST00000222013
Predicted Effect probably benign
Transcript: ENSMUST00000222481
Predicted Effect probably damaging
Transcript: ENSMUST00000222941
AA Change: L1592P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Adamts18 T A 8: 114,431,893 (GRCm39) E1105V probably benign Het
Colec10 A G 15: 54,325,796 (GRCm39) I209V possibly damaging Het
Cttnbp2 T G 6: 18,380,603 (GRCm39) S1422R possibly damaging Het
Dcst1 C G 3: 89,265,949 (GRCm39) V179L possibly damaging Het
Fbxw9 T C 8: 85,788,658 (GRCm39) Y165H probably benign Het
Fgl2 A T 5: 21,580,816 (GRCm39) Y386F probably damaging Het
Gabrb2 A G 11: 42,482,691 (GRCm39) Y183C probably damaging Het
Hlcs A G 16: 94,068,926 (GRCm39) L245P probably damaging Het
Hormad1 T A 3: 95,482,910 (GRCm39) I132K probably benign Het
Itga8 A T 2: 12,258,277 (GRCm39) D262E probably damaging Het
Jhy G A 9: 40,828,778 (GRCm39) T376I probably benign Het
Kif3b T C 2: 153,164,743 (GRCm39) I587T possibly damaging Het
Lrrc7 A G 3: 157,866,697 (GRCm39) Y1015H probably damaging Het
Lvrn T G 18: 47,011,230 (GRCm39) probably null Het
Mapkbp1 C A 2: 119,841,261 (GRCm39) Q83K probably damaging Het
Or2g25 T C 17: 37,971,044 (GRCm39) Y60C probably damaging Het
Or5b12 A T 19: 12,897,031 (GRCm39) I214N probably benign Het
Pigc T C 1: 161,798,579 (GRCm39) V187A possibly damaging Het
Ros1 A T 10: 52,039,991 (GRCm39) H333Q possibly damaging Het
Rreb1 T C 13: 38,100,513 (GRCm39) F215L probably benign Het
Rtcb C T 10: 85,779,697 (GRCm39) M324I probably benign Het
Senp2 A G 16: 21,837,125 (GRCm39) I125V possibly damaging Het
Shroom3 A G 5: 92,928,729 (GRCm39) K95E probably damaging Het
Wrnip1 C T 13: 32,986,410 (GRCm39) P64S probably benign Het
Zbtb24 C T 10: 41,327,264 (GRCm39) A50V probably damaging Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25,088,559 (GRCm39) splice site probably benign
IGL00959:Kidins220 APN 12 25,101,132 (GRCm39) missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25,107,473 (GRCm39) missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25,060,925 (GRCm39) missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25,088,498 (GRCm39) missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25,090,459 (GRCm39) missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 25,044,999 (GRCm39) missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25,107,728 (GRCm39) missense probably benign 0.00
IGL02160:Kidins220 APN 12 25,054,110 (GRCm39) missense probably damaging 1.00
IGL02383:Kidins220 APN 12 25,047,332 (GRCm39) splice site probably benign
IGL02673:Kidins220 APN 12 25,044,991 (GRCm39) missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25,053,092 (GRCm39) missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25,053,044 (GRCm39) missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25,058,447 (GRCm39) missense probably damaging 0.99
IGL03412:Kidins220 APN 12 25,049,344 (GRCm39) missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25,058,155 (GRCm39) missense probably damaging 1.00
R0011:Kidins220 UTSW 12 25,049,351 (GRCm39) missense probably damaging 0.99
R0011:Kidins220 UTSW 12 25,049,351 (GRCm39) missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25,090,511 (GRCm39) missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25,060,140 (GRCm39) missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25,058,068 (GRCm39) missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25,055,087 (GRCm39) missense probably benign 0.35
R1778:Kidins220 UTSW 12 25,063,445 (GRCm39) splice site probably benign
R1808:Kidins220 UTSW 12 25,053,008 (GRCm39) missense probably benign 0.00
R1855:Kidins220 UTSW 12 25,106,590 (GRCm39) missense probably damaging 1.00
R1965:Kidins220 UTSW 12 25,044,905 (GRCm39) missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25,101,193 (GRCm39) missense probably benign 0.01
R2069:Kidins220 UTSW 12 25,037,005 (GRCm39) splice site probably benign
R2101:Kidins220 UTSW 12 25,107,422 (GRCm39) missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25,091,302 (GRCm39) critical splice donor site probably null
R2405:Kidins220 UTSW 12 25,061,508 (GRCm39) missense probably damaging 0.99
R3522:Kidins220 UTSW 12 25,040,757 (GRCm39) missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25,051,564 (GRCm39) splice site probably benign
R3915:Kidins220 UTSW 12 25,103,957 (GRCm39) missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25,107,143 (GRCm39) splice site probably null
R4287:Kidins220 UTSW 12 25,106,845 (GRCm39) missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25,061,000 (GRCm39) missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25,088,301 (GRCm39) splice site probably null
R4627:Kidins220 UTSW 12 25,107,041 (GRCm39) missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25,107,284 (GRCm39) missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25,063,442 (GRCm39) critical splice donor site probably null
R4960:Kidins220 UTSW 12 25,042,259 (GRCm39) nonsense probably null
R5118:Kidins220 UTSW 12 25,042,296 (GRCm39) missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25,101,125 (GRCm39) missense probably benign 0.17
R5238:Kidins220 UTSW 12 25,053,009 (GRCm39) missense probably benign 0.31
R5580:Kidins220 UTSW 12 25,097,896 (GRCm39) missense probably benign 0.00
R5707:Kidins220 UTSW 12 25,063,390 (GRCm39) missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25,107,139 (GRCm39) nonsense probably null
R6131:Kidins220 UTSW 12 25,042,313 (GRCm39) splice site probably null
R6146:Kidins220 UTSW 12 25,102,812 (GRCm39) missense probably damaging 1.00
R6151:Kidins220 UTSW 12 25,106,908 (GRCm39) missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 25,047,310 (GRCm39) missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25,101,307 (GRCm39) splice site probably null
R6289:Kidins220 UTSW 12 25,106,615 (GRCm39) missense probably damaging 1.00
R6321:Kidins220 UTSW 12 25,107,533 (GRCm39) missense probably benign 0.09
R6450:Kidins220 UTSW 12 25,107,190 (GRCm39) missense probably benign
R6513:Kidins220 UTSW 12 25,088,434 (GRCm39) missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25,060,059 (GRCm39) splice site probably null
R6711:Kidins220 UTSW 12 25,048,750 (GRCm39) missense probably damaging 0.96
R6858:Kidins220 UTSW 12 25,058,542 (GRCm39) missense possibly damaging 0.85
R7102:Kidins220 UTSW 12 25,107,662 (GRCm39) missense probably benign 0.00
R7112:Kidins220 UTSW 12 25,054,018 (GRCm39) missense probably damaging 1.00
R7139:Kidins220 UTSW 12 25,044,820 (GRCm39) missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25,086,623 (GRCm39) missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25,061,570 (GRCm39) missense probably benign 0.21
R7361:Kidins220 UTSW 12 25,106,999 (GRCm39) missense probably benign 0.01
R7509:Kidins220 UTSW 12 25,032,360 (GRCm39) missense probably damaging 0.98
R7510:Kidins220 UTSW 12 25,042,268 (GRCm39) missense possibly damaging 0.88
R7783:Kidins220 UTSW 12 25,038,555 (GRCm39) missense probably damaging 1.00
R7796:Kidins220 UTSW 12 25,032,350 (GRCm39) missense probably damaging 0.96
R7831:Kidins220 UTSW 12 25,111,230 (GRCm39) missense possibly damaging 0.90
R8074:Kidins220 UTSW 12 25,107,715 (GRCm39) missense probably benign 0.29
R8214:Kidins220 UTSW 12 25,044,854 (GRCm39) missense probably damaging 1.00
R8304:Kidins220 UTSW 12 25,107,127 (GRCm39) missense probably benign 0.01
R8313:Kidins220 UTSW 12 25,054,110 (GRCm39) missense probably damaging 1.00
R8346:Kidins220 UTSW 12 25,086,533 (GRCm39) missense probably damaging 1.00
R8392:Kidins220 UTSW 12 25,040,727 (GRCm39) missense probably damaging 1.00
R8482:Kidins220 UTSW 12 25,090,527 (GRCm39) missense probably benign 0.00
R8722:Kidins220 UTSW 12 25,051,593 (GRCm39) missense probably benign
R8831:Kidins220 UTSW 12 25,086,454 (GRCm39) missense possibly damaging 0.70
R8960:Kidins220 UTSW 12 25,106,914 (GRCm39) missense probably benign 0.05
R9193:Kidins220 UTSW 12 25,036,966 (GRCm39) missense possibly damaging 0.79
R9267:Kidins220 UTSW 12 25,038,558 (GRCm39) missense probably benign 0.29
R9303:Kidins220 UTSW 12 25,107,110 (GRCm39) missense probably benign 0.36
R9343:Kidins220 UTSW 12 25,058,078 (GRCm39) missense probably damaging 1.00
R9526:Kidins220 UTSW 12 25,088,383 (GRCm39) missense probably damaging 1.00
R9644:Kidins220 UTSW 12 25,061,018 (GRCm39) missense probably damaging 1.00
R9655:Kidins220 UTSW 12 25,047,295 (GRCm39) missense probably damaging 1.00
R9664:Kidins220 UTSW 12 25,106,895 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GAGTCAGATAATACCCCACTGCTC -3'
(R):5'- TTTCTTCAGGGCTGCTAGCG -3'

Sequencing Primer
(F):5'- CCCACTGCTCAAAGATGATAAGG -3'
(R):5'- TAGCGATCAGGCTGCACTCAG -3'
Posted On 2014-11-11