Incidental Mutation 'R2371:Hlcs'
ID247541
Institutional Source Beutler Lab
Gene Symbol Hlcs
Ensembl Gene ENSMUSG00000040820
Gene Nameholocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
SynonymsD16Jhu34, 410I21.SP6
MMRRC Submission 040351-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R2371 (G1)
Quality Score188
Status Not validated
Chromosome16
Chromosomal Location94128882-94313571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94268067 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 245 (L245P)
Ref Sequence ENSEMBL: ENSMUSP00000153773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141]
Predicted Effect probably damaging
Transcript: ENSMUST00000099512
AA Change: L98P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: L98P

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 1.9e-21 PFAM
Pfam:BPL_C 665 714 3.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163193
AA Change: L98P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: L98P

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 3.6e-30 PFAM
Pfam:BPL_C 665 714 4.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226776
Predicted Effect probably damaging
Transcript: ENSMUST00000227141
AA Change: L245P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Adamts18 T A 8: 113,705,261 E1105V probably benign Het
Colec10 A G 15: 54,462,400 I209V possibly damaging Het
Cttnbp2 T G 6: 18,380,604 S1422R possibly damaging Het
Dcst1 C G 3: 89,358,642 V179L possibly damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fgl2 A T 5: 21,375,818 Y386F probably damaging Het
Gabrb2 A G 11: 42,591,864 Y183C probably damaging Het
Hormad1 T A 3: 95,575,599 I132K probably benign Het
Itga8 A T 2: 12,253,466 D262E probably damaging Het
Jhy G A 9: 40,917,482 T376I probably benign Het
Kidins220 T C 12: 25,057,324 L1592P probably damaging Het
Kif3b T C 2: 153,322,823 I587T possibly damaging Het
Lrrc7 A G 3: 158,161,060 Y1015H probably damaging Het
Lvrn T G 18: 46,878,163 probably null Het
Mapkbp1 C A 2: 120,010,780 Q83K probably damaging Het
Olfr117 T C 17: 37,660,153 Y60C probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Pigc T C 1: 161,971,010 V187A possibly damaging Het
Ros1 A T 10: 52,163,895 H333Q possibly damaging Het
Rreb1 T C 13: 37,916,537 F215L probably benign Het
Rtcb C T 10: 85,943,833 M324I probably benign Het
Senp2 A G 16: 22,018,375 I125V possibly damaging Het
Shroom3 A G 5: 92,780,870 K95E probably damaging Het
Wrnip1 C T 13: 32,802,427 P64S probably benign Het
Zbtb24 C T 10: 41,451,268 A50V probably damaging Het
Other mutations in Hlcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Hlcs APN 16 94133160 missense probably damaging 0.99
IGL02026:Hlcs APN 16 94134705 missense probably damaging 0.99
IGL02341:Hlcs APN 16 94231110 missense probably damaging 0.99
IGL03075:Hlcs APN 16 94138847 missense probably damaging 1.00
PIT4515001:Hlcs UTSW 16 94267416 missense probably benign 0.45
R0372:Hlcs UTSW 16 94138907 missense possibly damaging 0.69
R0664:Hlcs UTSW 16 94231311 missense probably damaging 1.00
R0731:Hlcs UTSW 16 94131852 missense probably damaging 1.00
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1761:Hlcs UTSW 16 94268007 missense probably benign 0.05
R2013:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2014:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2015:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2204:Hlcs UTSW 16 94231152 missense probably benign 0.30
R3816:Hlcs UTSW 16 94133088 missense probably benign 0.11
R3822:Hlcs UTSW 16 94267981 missense probably benign 0.04
R4422:Hlcs UTSW 16 94138960 missense possibly damaging 0.56
R4657:Hlcs UTSW 16 94262698 missense probably benign 0.00
R4783:Hlcs UTSW 16 94268539 missense possibly damaging 0.82
R5347:Hlcs UTSW 16 94267524 missense possibly damaging 0.93
R5808:Hlcs UTSW 16 94262632 missense probably benign 0.00
R5940:Hlcs UTSW 16 94134712 missense probably damaging 0.99
R6341:Hlcs UTSW 16 94231163 missense probably damaging 1.00
R6943:Hlcs UTSW 16 94141402 missense possibly damaging 0.75
R7053:Hlcs UTSW 16 94268015 missense possibly damaging 0.91
R7157:Hlcs UTSW 16 94268164 nonsense probably null
R7166:Hlcs UTSW 16 94262726 missense possibly damaging 0.92
R7313:Hlcs UTSW 16 94267503 missense probably damaging 1.00
X0065:Hlcs UTSW 16 94133173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAAGATATTGGGCGC -3'
(R):5'- AAGCCTCCGACAAGCAAGTG -3'

Sequencing Primer
(F):5'- CAGCAAGATATTGGGCGCCTTTC -3'
(R):5'- AAGCAAGTGCAGGGCCC -3'
Posted On2014-11-11