Incidental Mutation 'R2382:Eif4g2'
ID247568
Institutional Source Beutler Lab
Gene Symbol Eif4g2
Ensembl Gene ENSMUSG00000005610
Gene Nameeukaryotic translation initiation factor 4, gamma 2
SynonymsDAP-5, Nat1, E130105L11Rik, Natm1
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2382 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location111067750-111083030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111075046 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 613 (T613S)
Ref Sequence ENSEMBL: ENSMUSP00000124551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159305] [ENSMUST00000160132] [ENSMUST00000161051] [ENSMUST00000162415]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158323
Predicted Effect probably benign
Transcript: ENSMUST00000159305
SMART Domains Protein: ENSMUSP00000125098
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
Blast:MIF4G 32 83 4e-22 BLAST
SCOP:d1hu3a_ 67 102 9e-13 SMART
PDB:4IUL|B 70 102 3e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159465
Predicted Effect probably benign
Transcript: ENSMUST00000160132
SMART Domains Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
Pfam:MIF4G 78 152 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160552
Predicted Effect probably benign
Transcript: ENSMUST00000161051
AA Change: T575S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: T575S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
MA3 505 618 4.76e-35 SMART
low complexity region 634 646 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 760 771 N/A INTRINSIC
eIF5C 775 861 5.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161790
Predicted Effect probably benign
Transcript: ENSMUST00000162415
AA Change: T613S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: T613S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
low complexity region 441 453 N/A INTRINSIC
Blast:MIF4G 454 490 4e-14 BLAST
MA3 543 656 4.76e-35 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
eIF5C 813 899 5.43e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163014
SMART Domains Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:W2 52 122 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aarsd1 T A 11: 101,414,078 I64F probably damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
E030025P04Rik G A 11: 109,144,054 Q3* probably null Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Mgat5b T A 11: 116,919,496 D7E probably damaging Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnliprp2 A G 19: 58,768,630 N308S probably benign Het
Ppwd1 T C 13: 104,207,113 T595A probably damaging Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Rab11fip3 T A 17: 25,990,867 K1062* probably null Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in Eif4g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Eif4g2 APN 7 111074713 missense possibly damaging 0.91
IGL01402:Eif4g2 APN 7 111077027 missense possibly damaging 0.94
IGL02502:Eif4g2 APN 7 111081541 missense probably damaging 0.98
IGL02538:Eif4g2 APN 7 111079316 missense probably benign 0.03
IGL02717:Eif4g2 APN 7 111078113 missense probably benign 0.45
R0547:Eif4g2 UTSW 7 111078293 missense probably damaging 1.00
R0614:Eif4g2 UTSW 7 111077223 critical splice donor site probably null
R1351:Eif4g2 UTSW 7 111074080 missense probably damaging 1.00
R1764:Eif4g2 UTSW 7 111074487 missense probably damaging 1.00
R2009:Eif4g2 UTSW 7 111074198 missense probably benign 0.01
R2318:Eif4g2 UTSW 7 111073858 missense possibly damaging 0.78
R2986:Eif4g2 UTSW 7 111078483 missense probably damaging 0.99
R4012:Eif4g2 UTSW 7 111074151 missense possibly damaging 0.86
R4592:Eif4g2 UTSW 7 111078302 missense probably damaging 1.00
R4785:Eif4g2 UTSW 7 111076796 missense probably damaging 0.99
R5037:Eif4g2 UTSW 7 111077032 missense probably benign 0.03
R5627:Eif4g2 UTSW 7 111074239 missense probably benign 0.32
R5988:Eif4g2 UTSW 7 111077230 missense probably benign 0.11
R6229:Eif4g2 UTSW 7 111077713 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTGAGCTAGTTCGGAAATGCTC -3'
(R):5'- TGGAAATGCCAACGACGCTG -3'

Sequencing Primer
(F):5'- CTGTGCCAAGTAAGATTTCACCAAGG -3'
(R):5'- AACGACGCTGTCAGTGGTG -3'
Posted On2014-11-11