Incidental Mutation 'R2382:Pnliprp2'
ID247588
Institutional Source Beutler Lab
Gene Symbol Pnliprp2
Ensembl Gene ENSMUSG00000025091
Gene Namepancreatic lipase-related protein 2
SynonymsPLRP2
MMRRC Submission 040357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2382 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location58759723-58777533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58768630 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 308 (N308S)
Ref Sequence ENSEMBL: ENSMUSP00000026081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026081]
Predicted Effect probably benign
Transcript: ENSMUST00000026081
AA Change: N308S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: N308S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Lipase 31 367 4.1e-166 PFAM
LH2 370 482 7.49e-27 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aarsd1 T A 11: 101,414,078 I64F probably damaging Het
Agrn T A 4: 156,176,516 D574V probably damaging Het
Atg4b T C 1: 93,784,842 C16R probably damaging Het
Ccdc141 A T 2: 77,011,542 L1515Q probably damaging Het
Ccdc141 A T 2: 77,074,998 V368E probably benign Het
Clk1 A T 1: 58,421,289 S61T probably benign Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Dner C G 1: 84,370,823 E719Q probably damaging Het
E030025P04Rik G A 11: 109,144,054 Q3* probably null Het
Eif4g2 T A 7: 111,075,046 T613S probably benign Het
Fn1 C G 1: 71,648,119 G193A probably damaging Het
Gls2 A G 10: 128,203,842 E286G probably damaging Het
Gm21286 A G 4: 60,838,284 noncoding transcript Het
Gm6614 G A 6: 141,990,480 S293F probably benign Het
Gm813 T C 16: 58,615,876 probably null Het
Hoxa13 A T 6: 52,259,145 V304D probably damaging Het
Hpse2 A T 19: 42,931,622 M346K probably benign Het
Igkv1-99 A T 6: 68,542,497 probably benign Het
Kcnq2 A G 2: 181,112,107 Y237H probably damaging Het
Kmt2a T A 9: 44,820,910 probably benign Het
Kntc1 A G 5: 123,760,348 D180G probably damaging Het
Macf1 G A 4: 123,374,832 T4682M probably damaging Het
Mfsd6 T A 1: 52,708,410 H432L probably benign Het
Mgat5b T A 11: 116,919,496 D7E probably damaging Het
Msh6 G A 17: 87,984,731 V305I probably benign Het
Notch1 A T 2: 26,473,781 H880Q probably benign Het
Olfr117 A C 17: 37,659,931 V134G probably benign Het
Olfr1353 G A 10: 78,970,156 C169Y probably damaging Het
Olfr57 A T 10: 79,035,134 I113F possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppwd1 T C 13: 104,207,113 T595A probably damaging Het
Prdm13 T C 4: 21,678,277 T738A possibly damaging Het
Rab11fip3 T A 17: 25,990,867 K1062* probably null Het
Reep3 A T 10: 67,096,790 V11E possibly damaging Het
Slco3a1 T C 7: 74,346,776 D294G probably benign Het
Sycp2 A G 2: 178,378,018 probably null Het
Zfp292 A G 4: 34,806,426 V2206A possibly damaging Het
Other mutations in Pnliprp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Pnliprp2 APN 19 58760497 missense probably benign
IGL02739:Pnliprp2 APN 19 58760509 critical splice donor site probably null
IGL02881:Pnliprp2 APN 19 58771446 missense probably benign 0.01
IGL03411:Pnliprp2 APN 19 58760415 missense probably benign
R0140:Pnliprp2 UTSW 19 58766363 missense probably benign 0.00
R0558:Pnliprp2 UTSW 19 58774087 missense probably benign 0.00
R1873:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1874:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1875:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R3893:Pnliprp2 UTSW 19 58766273 missense probably benign 0.19
R3915:Pnliprp2 UTSW 19 58760362 missense probably damaging 1.00
R4620:Pnliprp2 UTSW 19 58762286 missense possibly damaging 0.67
R4893:Pnliprp2 UTSW 19 58771421 missense probably benign 0.08
R4957:Pnliprp2 UTSW 19 58775145 missense possibly damaging 0.72
R4959:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R4973:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R5346:Pnliprp2 UTSW 19 58759800 missense probably benign
R6049:Pnliprp2 UTSW 19 58760452 missense possibly damaging 0.77
R6228:Pnliprp2 UTSW 19 58763442 critical splice donor site probably null
R6394:Pnliprp2 UTSW 19 58761598 missense probably benign
R6829:Pnliprp2 UTSW 19 58759873 missense probably benign
R7235:Pnliprp2 UTSW 19 58775227 missense probably benign 0.03
X0058:Pnliprp2 UTSW 19 58774142 missense possibly damaging 0.59
Z1088:Pnliprp2 UTSW 19 58762325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCAGTCTTCAGCAGCTC -3'
(R):5'- TTGAAAACTTCTGCATGTCCCC -3'

Sequencing Primer
(F):5'- AGTCTTCAGCAGCTCCCTGG -3'
(R):5'- GAAAACTTCTGCATGTCCCCTCTAC -3'
Posted On2014-11-11