Incidental Mutation 'R2383:Tiam1'
ID247618
Institutional Source Beutler Lab
Gene Symbol Tiam1
Ensembl Gene ENSMUSG00000002489
Gene NameT cell lymphoma invasion and metastasis 1
SynonymsD16Ium10e, D16Ium10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location89787111-90143769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89798684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1303 (V1303A)
Ref Sequence ENSEMBL: ENSMUSP00000132137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002588] [ENSMUST00000114122] [ENSMUST00000114124] [ENSMUST00000144691] [ENSMUST00000163370] [ENSMUST00000164263]
Predicted Effect probably benign
Transcript: ENSMUST00000002588
AA Change: V1303A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002588
Gene: ENSMUSG00000002489
AA Change: V1303A

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114122
SMART Domains Protein: ENSMUSP00000109757
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
PDZ 44 116 1.15e-5 SMART
low complexity region 201 216 N/A INTRINSIC
RhoGEF 232 421 1.42e-63 SMART
PH 450 585 9.58e-2 SMART
low complexity region 633 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114124
SMART Domains Protein: ENSMUSP00000109759
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134021
AA Change: V18A
Predicted Effect probably benign
Transcript: ENSMUST00000144691
SMART Domains Protein: ENSMUSP00000136283
Gene: ENSMUSG00000002489

DomainStartEndE-ValueType
Blast:PH 1 52 2e-30 BLAST
SCOP:d1foea2 1 56 2e-30 SMART
PDB:1FOE|G 1 61 5e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163370
AA Change: V1303A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132137
Gene: ENSMUSG00000002489
AA Change: V1303A

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164263
AA Change: V334A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126020
Gene: ENSMUSG00000002489
AA Change: V334A

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
RhoGEF 75 264 1.42e-63 SMART
PH 293 428 9.58e-2 SMART
low complexity region 476 485 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178095
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele display resistance to chemically-induced tumors, however, tumors that do develop progress to malignancy. Mice homozygous for a gene trap allele display anencephaly, exencephaly and/or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Tiam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tiam1 APN 16 89794739 missense probably damaging 1.00
IGL01356:Tiam1 APN 16 89837788 missense probably damaging 0.99
IGL01583:Tiam1 APN 16 89789280 missense probably damaging 1.00
IGL01626:Tiam1 APN 16 89812968 missense probably damaging 1.00
IGL01802:Tiam1 APN 16 89898372 missense possibly damaging 0.94
IGL01818:Tiam1 APN 16 89867704 missense probably damaging 1.00
IGL02146:Tiam1 APN 16 89849681 missense probably benign 0.20
IGL02329:Tiam1 APN 16 89800036 missense probably benign 0.08
IGL02341:Tiam1 APN 16 89898369 missense probably damaging 1.00
IGL02622:Tiam1 APN 16 89798700 missense possibly damaging 0.59
F5770:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
PIT4515001:Tiam1 UTSW 16 89860242 missense probably damaging 0.99
R0130:Tiam1 UTSW 16 89897754 missense probably benign 0.01
R0143:Tiam1 UTSW 16 89898200 missense probably benign 0.01
R0158:Tiam1 UTSW 16 89793001 critical splice donor site probably benign
R0413:Tiam1 UTSW 16 89809365 splice site probably benign
R0449:Tiam1 UTSW 16 89837827 missense possibly damaging 0.75
R0520:Tiam1 UTSW 16 89817951 splice site probably benign
R0667:Tiam1 UTSW 16 89897984 missense probably damaging 1.00
R0787:Tiam1 UTSW 16 89789561 missense probably damaging 1.00
R1355:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1370:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1534:Tiam1 UTSW 16 89867508 critical splice donor site probably null
R1769:Tiam1 UTSW 16 89860279 missense probably damaging 1.00
R1831:Tiam1 UTSW 16 89860294 missense probably benign 0.01
R1913:Tiam1 UTSW 16 89798694 missense probably damaging 1.00
R2022:Tiam1 UTSW 16 89877187 missense probably benign
R2140:Tiam1 UTSW 16 89849645 splice site probably benign
R2697:Tiam1 UTSW 16 89793164 missense probably benign 0.00
R4118:Tiam1 UTSW 16 89877033 splice site probably null
R4327:Tiam1 UTSW 16 89855891 missense possibly damaging 0.80
R4693:Tiam1 UTSW 16 89843282 missense possibly damaging 0.87
R5104:Tiam1 UTSW 16 89818041 missense probably benign 0.00
R5412:Tiam1 UTSW 16 89884865 missense possibly damaging 0.52
R5426:Tiam1 UTSW 16 89865392 missense possibly damaging 0.58
R5600:Tiam1 UTSW 16 89865365 missense probably damaging 1.00
R5842:Tiam1 UTSW 16 89855999 missense probably benign
R5986:Tiam1 UTSW 16 89789186 missense probably benign 0.31
R6077:Tiam1 UTSW 16 89798030 critical splice donor site probably null
R6419:Tiam1 UTSW 16 89898024 nonsense probably null
R6525:Tiam1 UTSW 16 89858597 critical splice donor site probably null
R6950:Tiam1 UTSW 16 89860204 critical splice donor site probably null
R7127:Tiam1 UTSW 16 89860260 missense probably damaging 1.00
R7197:Tiam1 UTSW 16 89884938 missense probably damaging 1.00
R7249:Tiam1 UTSW 16 89843255 missense probably damaging 1.00
V7582:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGCTCAGTATGTATCTGCTC -3'
(R):5'- TCCTTCAGCTACTACAGTGAGC -3'

Sequencing Primer
(F):5'- CAGTATGTATCTGCTCATGTGC -3'
(R):5'- GTGAGCACAGCTAAGTTTAAACC -3'
Posted On2014-11-11