Incidental Mutation 'R2384:Sele'
ID247628
Institutional Source Beutler Lab
Gene Symbol Sele
Ensembl Gene ENSMUSG00000026582
Gene Nameselectin, endothelial cell
SynonymsCD62E, E-selectin, Elam
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164048234-164057677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164050775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000027874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027874]
Predicted Effect probably benign
Transcript: ENSMUST00000027874
AA Change: T228A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: T228A

DomainStartEndE-ValueType
CLECT 21 146 1.45e-21 SMART
EGF 149 182 2.83e-5 SMART
CCP 187 245 1.49e-9 SMART
CCP 250 307 5.43e-12 SMART
CCP 312 370 1.82e-13 SMART
CCP 375 433 1.36e-12 SMART
CCP 438 496 6e-14 SMART
CCP 501 555 1.39e-9 SMART
transmembrane domain 565 587 N/A INTRINSIC
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Sele
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Sele APN 1 164051834 missense probably damaging 1.00
IGL02097:Sele APN 1 164053093 missense probably benign 0.02
IGL02243:Sele APN 1 164052968 missense probably benign 0.01
IGL02688:Sele APN 1 164050130 missense probably damaging 1.00
IGL03022:Sele APN 1 164054679 missense probably benign 0.01
R0433:Sele UTSW 1 164049244 missense possibly damaging 0.74
R0487:Sele UTSW 1 164053615 nonsense probably null
R0678:Sele UTSW 1 164054729 critical splice donor site probably null
R1295:Sele UTSW 1 164050810 missense probably damaging 1.00
R1296:Sele UTSW 1 164050810 missense probably damaging 1.00
R1532:Sele UTSW 1 164053851 missense probably benign 0.29
R1730:Sele UTSW 1 164054623 missense probably benign
R2102:Sele UTSW 1 164053826 missense probably damaging 1.00
R3001:Sele UTSW 1 164053571 missense probably damaging 1.00
R3002:Sele UTSW 1 164053571 missense probably damaging 1.00
R5851:Sele UTSW 1 164049574 missense probably benign 0.06
R6164:Sele UTSW 1 164051817 splice site probably null
R6239:Sele UTSW 1 164050808 missense probably damaging 0.98
R6406:Sele UTSW 1 164050743 missense probably damaging 1.00
R6411:Sele UTSW 1 164049415 missense probably benign 0.03
R6731:Sele UTSW 1 164053673 missense probably damaging 1.00
R6851:Sele UTSW 1 164053952 missense probably damaging 1.00
R7291:Sele UTSW 1 164053868 missense possibly damaging 0.89
R7328:Sele UTSW 1 164049275 missense probably benign 0.23
R7366:Sele UTSW 1 164048719 missense probably benign 0.00
R7393:Sele UTSW 1 164053923 missense probably benign 0.05
X0005:Sele UTSW 1 164049343 missense probably damaging 1.00
X0021:Sele UTSW 1 164053611 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GAGATGAGCAGACGTGTGTC -3'
(R):5'- ATGCGTCACCAGGATCTCAG -3'

Sequencing Primer
(F):5'- GACGTGTGTCTTGATTCGTTG -3'
(R):5'- TGCGTCACCAGGATCTCAGAAATAC -3'
Posted On2014-11-11