Incidental Mutation 'R2384:Ucp2'
ID247641
Institutional Source Beutler Lab
Gene Symbol Ucp2
Ensembl Gene ENSMUSG00000033685
Gene Nameuncoupling protein 2 (mitochondrial, proton carrier)
Synonyms
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100493337-100502020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100498254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 172 (I172V)
Ref Sequence ENSEMBL: ENSMUSP00000146337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126534] [ENSMUST00000129324] [ENSMUST00000133044] [ENSMUST00000153287] [ENSMUST00000154516] [ENSMUST00000207405] [ENSMUST00000207748]
Predicted Effect probably benign
Transcript: ENSMUST00000054923
SMART Domains Protein: ENSMUSP00000059074
Gene: ENSMUSG00000030708

DomainStartEndE-ValueType
DnaJ 3 60 3.52e-23 SMART
Pfam:DnaJ_C 140 299 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126381
Predicted Effect probably benign
Transcript: ENSMUST00000126534
AA Change: I172V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120967
Gene: ENSMUSG00000033685
AA Change: I172V

DomainStartEndE-ValueType
Pfam:Mito_carr 10 111 1.3e-21 PFAM
Pfam:Mito_carr 112 208 2e-27 PFAM
Pfam:Mito_carr 211 302 5.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129324
SMART Domains Protein: ENSMUSP00000115648
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 65 8.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130534
Predicted Effect probably benign
Transcript: ENSMUST00000133044
AA Change: I172V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115598
Gene: ENSMUSG00000033685
AA Change: I172V

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 2.6e-23 PFAM
Pfam:Mito_carr 112 172 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151221
Predicted Effect probably benign
Transcript: ENSMUST00000153287
SMART Domains Protein: ENSMUSP00000115953
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154516
Predicted Effect probably benign
Transcript: ENSMUST00000207405
Predicted Effect probably benign
Transcript: ENSMUST00000207748
AA Change: I172V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207890
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have elevated pancreatic islet cell ATP levels and increased glucose-stimulated secretion of insulin. Homozygotes also show reduced mitochondrial proton leak in thymocytes and increased resistance to infection by Toxoplasma gondii. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Ucp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Ucp2 APN 7 100498422 missense probably benign
IGL02184:Ucp2 APN 7 100499322 missense probably benign
IGL02370:Ucp2 APN 7 100498384 missense probably damaging 0.96
IGL02449:Ucp2 APN 7 100498810 missense probably damaging 1.00
R1808:Ucp2 UTSW 7 100498814 missense probably damaging 0.97
R1809:Ucp2 UTSW 7 100498399 missense probably damaging 0.98
R2508:Ucp2 UTSW 7 100498413 missense probably benign
R2866:Ucp2 UTSW 7 100497252 missense probably benign 0.31
R4400:Ucp2 UTSW 7 100499350 makesense probably null
R5022:Ucp2 UTSW 7 100498372 missense possibly damaging 0.74
R6073:Ucp2 UTSW 7 100498131 missense possibly damaging 0.96
R6530:Ucp2 UTSW 7 100498223 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGGCAAGAGCATGATGC -3'
(R):5'- ACCTGTCATGAGGTTGGCTTTC -3'

Sequencing Primer
(F):5'- TCTTGCCCACAGATGCAG -3'
(R):5'- CAGGAGAGTATCTTTGATGAGGTC -3'
Posted On2014-11-11