Incidental Mutation 'R2384:Tmem161a'
ID247643
Institutional Source Beutler Lab
Gene Symbol Tmem161a
Ensembl Gene ENSMUSG00000002342
Gene Nametransmembrane protein 161A
Synonyms
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70172356-70183681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70177554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000123084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002413] [ENSMUST00000147656] [ENSMUST00000149105] [ENSMUST00000182365] [ENSMUST00000182715] [ENSMUST00000182980]
Predicted Effect probably benign
Transcript: ENSMUST00000002413
AA Change: V130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002413
Gene: ENSMUSG00000002342
AA Change: V130A

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 478 6.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125755
Predicted Effect silent
Transcript: ENSMUST00000125906
SMART Domains Protein: ENSMUSP00000137791
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 119 8.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143543
Predicted Effect probably benign
Transcript: ENSMUST00000147656
AA Change: V130A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138017
Gene: ENSMUSG00000002342
AA Change: V130A

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 270 4.6e-122 PFAM
low complexity region 283 296 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149105
AA Change: V104A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123084
Gene: ENSMUSG00000002342
AA Change: V104A

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 95 5.1e-41 PFAM
Pfam:Tmemb_161AB 93 454 9.5e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182365
SMART Domains Protein: ENSMUSP00000138641
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 98 3.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182715
SMART Domains Protein: ENSMUSP00000138432
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 45 3.3e-15 PFAM
low complexity region 152 165 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182942
Predicted Effect probably benign
Transcript: ENSMUST00000182980
SMART Domains Protein: ENSMUSP00000138499
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 328 4.6e-133 PFAM
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cnp A G 11: 100,576,453 Y74C probably damaging Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Tmem161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Tmem161a APN 8 70178974 missense probably damaging 1.00
IGL02425:Tmem161a APN 8 70176927 critical splice donor site probably null
IGL02597:Tmem161a APN 8 70182043 missense probably damaging 1.00
IGL02622:Tmem161a APN 8 70181237 nonsense probably null
PIT4431001:Tmem161a UTSW 8 70182024 missense probably damaging 0.99
R0498:Tmem161a UTSW 8 70180973 missense probably benign 0.00
R1881:Tmem161a UTSW 8 70180785 missense probably null 1.00
R1970:Tmem161a UTSW 8 70176909 missense probably damaging 1.00
R1971:Tmem161a UTSW 8 70176909 missense probably damaging 1.00
R2027:Tmem161a UTSW 8 70177520 missense probably damaging 1.00
R2870:Tmem161a UTSW 8 70178915 intron probably benign
R2872:Tmem161a UTSW 8 70178915 intron probably benign
R4271:Tmem161a UTSW 8 70181512 missense probably damaging 1.00
R4284:Tmem161a UTSW 8 70177426 intron probably benign
R4576:Tmem161a UTSW 8 70182063 unclassified probably null
R4677:Tmem161a UTSW 8 70180947 unclassified probably null
R6322:Tmem161a UTSW 8 70182114 missense probably damaging 1.00
R6823:Tmem161a UTSW 8 70181199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTAGGTAACACCCAG -3'
(R):5'- GAGTTCAAAATCAGGATGGCC -3'

Sequencing Primer
(F):5'- CAGCTGCTGGGGTCATTC -3'
(R):5'- GATGGCCTGCATCCTCTGAC -3'
Posted On2014-11-11