Incidental Mutation 'R2384:Cnp'
ID247654
Institutional Source Beutler Lab
Gene Symbol Cnp
Ensembl Gene ENSMUSG00000006782
Gene Name2',3'-cyclic nucleotide 3' phosphodiesterase
SynonymsCNPase, Cnp-1, Cnp1
MMRRC Submission 040358-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R2384 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100574904-100591729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100576453 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 74 (Y74C)
Ref Sequence ENSEMBL: ENSMUSP00000099409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684] [ENSMUST00000103120]
PDB Structure
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with citrate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, complexed with sulfate [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic NADP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with GTP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, soaked with 2',3'-cyclic AMP [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, crystallized with 2'-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3-(SP)-Cyclic-AMPS [X-RAY DIFFRACTION]
Catalytic domain of mouse 2',3'-cyclic nucleotide 3'- phosphodiesterase, with mutation H309S, crystallized with 2',3'- cyclic AMP [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000006976
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092684
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103120
AA Change: Y74C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099409
Gene: ENSMUSG00000006782
AA Change: Y74C

DomainStartEndE-ValueType
Pfam:AAA_33 52 175 8.9e-10 PFAM
Pfam:CNPase 185 419 7.1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150414
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in ataxia, gait abnormalities, hindlimb paralysis, muscle weakness, convulsive seizures, weight loss, kyphosis, reactive gliosis, axonal swellings and degeneration, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933414I15Rik A G 11: 50,942,506 S90P unknown Het
Abca13 T C 11: 9,267,450 probably benign Het
Chpf C T 1: 75,475,109 R567H probably benign Het
Cul3 A T 1: 80,283,689 V273D probably damaging Het
Dnmt3a A G 12: 3,901,591 Y656C probably damaging Het
Erich3 A T 3: 154,764,651 E107V possibly damaging Het
Fscn2 T C 11: 120,366,733 S307P possibly damaging Het
Gm156 T A 6: 129,772,380 H84L probably benign Het
Grm5 A G 7: 87,602,728 E62G probably damaging Het
Hdac4 T C 1: 91,984,485 Y394C probably benign Het
Hipk2 A G 6: 38,818,371 I314T probably damaging Het
Hsd17b12 T A 2: 94,033,619 I293L probably benign Het
Il1f9 A G 2: 24,192,648 H145R probably benign Het
Ints12 T A 3: 133,109,103 probably null Het
Khdrbs2 T C 1: 32,519,895 S369G probably damaging Het
Mup5 T A 4: 61,835,024 probably null Het
Nlrp4g A G 9: 124,349,707 noncoding transcript Het
Obscn A G 11: 59,042,837 probably null Het
Ogdh C A 11: 6,342,526 A413D probably damaging Het
Podn T C 4: 108,022,072 E283G probably damaging Het
Ppp1r32 A C 19: 10,481,282 probably null Het
Ripk1 A G 13: 34,030,043 D456G probably benign Het
Scg3 T C 9: 75,665,726 T308A probably damaging Het
Sele A G 1: 164,050,775 T228A probably benign Het
Slc41a3 A G 6: 90,626,411 E138G probably damaging Het
Tmem161a T C 8: 70,177,554 V104A probably benign Het
Tmem232 G A 17: 65,402,857 R479W probably damaging Het
Trim26 C T 17: 36,850,889 P67S probably damaging Het
Trpm8 A G 1: 88,359,656 Y787C probably benign Het
Ttc28 T A 5: 111,276,208 V1447D possibly damaging Het
Uaca G A 9: 60,869,917 A527T probably damaging Het
Ucp2 A G 7: 100,498,254 I172V probably benign Het
Zzef1 T A 11: 72,858,394 Y903N probably damaging Het
Other mutations in Cnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Cnp APN 11 100576699 missense probably benign 0.25
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0004:Cnp UTSW 11 100576807 missense probably damaging 1.00
R0015:Cnp UTSW 11 100578908 splice site probably null
R0015:Cnp UTSW 11 100578908 splice site probably null
R0546:Cnp UTSW 11 100580723 missense probably damaging 1.00
R4653:Cnp UTSW 11 100576516 missense probably benign 0.19
R4654:Cnp UTSW 11 100579051 missense possibly damaging 0.90
R4898:Cnp UTSW 11 100576376 missense probably benign 0.11
R5559:Cnp UTSW 11 100576417 missense probably damaging 1.00
R7045:Cnp UTSW 11 100580358 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCAAGCTCTTCTTCAGG -3'
(R):5'- TTGAGCTGGGCACAGTCTAGTC -3'

Sequencing Primer
(F):5'- CTTCAGGAAAATGTCATCCTCAGGAG -3'
(R):5'- CTGGTCTGCCATTTCAAAAAGCTG -3'
Posted On2014-11-11