Mutagenetix > Incidental Mutation

Incidental Mutation 'R2385:Snx13'

247683

Institutional Source

Beutler Lab

Gene Symbol

Snx13

Ensembl Gene

ENSMUSG00000020590

Gene Name

sorting nexin 13

Synonyms

RGS-PX1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2385 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35097191-35197479 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35169792 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 579 (Y579F)

Ref Sequence

ENSEMBL: ENSMUSP00000130182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048519] [ENSMUST00000163677] [ENSMUST00000221272]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048519
AA Change: Y579F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590
AA Change: Y579F

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	34	51	N/A	INTRINSIC
PXA	98	285	9.09e-102	SMART
coiled coil region	293	320	N/A	INTRINSIC
RGS	374	514	4.63e-32	SMART
low complexity region	546	562	N/A	INTRINSIC
PX	564	677	2.88e-31	SMART
Pfam:Nexin_C	793	903	1.9e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163677
AA Change: Y579F

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130182
Gene: ENSMUSG00000020590
AA Change: Y579F

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	34	51	N/A	INTRINSIC
PXA	97	284	9.09e-102	SMART
coiled coil region	292	319	N/A	INTRINSIC
RGS	373	513	4.63e-32	SMART
low complexity region	545	561	N/A	INTRINSIC
PX	563	676	2.88e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221272

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221876

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abra	T	C	15: 41,732,749 (GRCm39)	T106A	probably damaging	Het
Adgra3	A	T	5: 50,136,908 (GRCm39)	I595N	possibly damaging	Het
Aox3	A	G	1: 58,177,448 (GRCm39)	E221G	probably damaging	Het
Arpc1a	T	A	5: 145,041,333 (GRCm39)		probably null	Het
Cd180	A	G	13: 102,841,691 (GRCm39)	T246A	probably benign	Het
Cep250	A	G	2: 155,816,261 (GRCm39)	E672G	probably damaging	Het
Cyp2d12	A	T	15: 82,442,696 (GRCm39)	I380F	probably benign	Het
Dock3	A	T	9: 106,868,324 (GRCm39)	D653E	probably damaging	Het
Fbxw22	A	G	9: 109,211,210 (GRCm39)	S364P	probably damaging	Het
Ift122	T	C	6: 115,889,483 (GRCm39)	Y823H	probably benign	Het
Kif20b	T	C	19: 34,936,819 (GRCm39)	S1365P	probably damaging	Het
Nol11	C	T	11: 107,080,032 (GRCm39)	G18R	probably benign	Het
Or8k3	A	T	2: 86,058,817 (GRCm39)	L166*	probably null	Het
Pde8a	T	G	7: 80,932,740 (GRCm39)	M134R	probably benign	Het
Pmepa1	G	A	2: 173,069,926 (GRCm39)	R210W	probably damaging	Het
Polr3gl	A	G	3: 96,485,862 (GRCm39)	F135L	probably damaging	Het
Sdr16c6	T	A	4: 4,062,671 (GRCm39)	I216F	probably damaging	Het
Slc23a2	T	C	2: 131,931,121 (GRCm39)	D126G	probably benign	Het
Vcan	T	C	13: 89,837,568 (GRCm39)	T1699A	probably damaging	Het

Other mutations in Snx13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Snx13	APN	12	35,148,279 (GRCm39)	missense	probably damaging	1.00
IGL01143:Snx13	APN	12	35,182,159 (GRCm39)	missense	probably damaging	0.96
IGL01446:Snx13	APN	12	35,174,479 (GRCm39)	nonsense	probably null
IGL01519:Snx13	APN	12	35,188,471 (GRCm39)	unclassified	probably benign
IGL01902:Snx13	APN	12	35,183,306 (GRCm39)	critical splice acceptor site	probably null
IGL01903:Snx13	APN	12	35,135,968 (GRCm39)	missense	probably benign	0.06
IGL02146:Snx13	APN	12	35,151,078 (GRCm39)	missense	probably benign	0.00
IGL02175:Snx13	APN	12	35,182,061 (GRCm39)	missense	possibly damaging	0.83
IGL02197:Snx13	APN	12	35,156,800 (GRCm39)	missense	probably damaging	1.00
IGL02200:Snx13	APN	12	35,136,884 (GRCm39)	missense	probably damaging	1.00
IGL02476:Snx13	APN	12	35,136,940 (GRCm39)	missense	probably damaging	1.00
IGL03171:Snx13	APN	12	35,150,539 (GRCm39)	missense	probably benign	0.28
resistance	UTSW	12	35,162,444 (GRCm39)	missense	probably damaging	1.00
IGL02835:Snx13	UTSW	12	35,182,126 (GRCm39)	missense	possibly damaging	0.48
P0042:Snx13	UTSW	12	35,157,541 (GRCm39)	missense	probably damaging	1.00
R0047:Snx13	UTSW	12	35,151,123 (GRCm39)	splice site	probably benign
R0047:Snx13	UTSW	12	35,151,123 (GRCm39)	splice site	probably benign
R0344:Snx13	UTSW	12	35,136,899 (GRCm39)	nonsense	probably null
R1240:Snx13	UTSW	12	35,141,405 (GRCm39)	missense	probably damaging	0.99
R1335:Snx13	UTSW	12	35,182,123 (GRCm39)	missense	probably benign	0.16
R1451:Snx13	UTSW	12	35,128,983 (GRCm39)	missense	probably benign	0.00
R1617:Snx13	UTSW	12	35,136,895 (GRCm39)	missense	probably damaging	0.99
R2065:Snx13	UTSW	12	35,188,065 (GRCm39)	missense	possibly damaging	0.91
R2111:Snx13	UTSW	12	35,188,084 (GRCm39)	missense	probably damaging	1.00
R2437:Snx13	UTSW	12	35,132,926 (GRCm39)	missense	probably benign	0.14
R2511:Snx13	UTSW	12	35,188,080 (GRCm39)	missense	probably benign	0.13
R2860:Snx13	UTSW	12	35,188,116 (GRCm39)	missense	probably benign	0.45
R2861:Snx13	UTSW	12	35,188,116 (GRCm39)	missense	probably benign	0.45
R2862:Snx13	UTSW	12	35,188,116 (GRCm39)	missense	probably benign	0.45
R2992:Snx13	UTSW	12	35,155,190 (GRCm39)	missense	probably damaging	1.00
R3938:Snx13	UTSW	12	35,194,096 (GRCm39)	missense	probably benign	0.10
R4304:Snx13	UTSW	12	35,172,941 (GRCm39)	missense	probably benign	0.10
R4532:Snx13	UTSW	12	35,194,219 (GRCm39)	missense	probably damaging	0.98
R4692:Snx13	UTSW	12	35,136,917 (GRCm39)	missense	possibly damaging	0.82
R4783:Snx13	UTSW	12	35,148,285 (GRCm39)	missense	probably damaging	1.00
R4914:Snx13	UTSW	12	35,182,032 (GRCm39)	missense	possibly damaging	0.84
R5309:Snx13	UTSW	12	35,194,324 (GRCm39)	nonsense	probably null
R5425:Snx13	UTSW	12	35,150,643 (GRCm39)	nonsense	probably null
R5476:Snx13	UTSW	12	35,156,819 (GRCm39)	splice site	probably null
R5533:Snx13	UTSW	12	35,173,025 (GRCm39)	critical splice donor site	probably null
R5564:Snx13	UTSW	12	35,174,471 (GRCm39)	missense	possibly damaging	0.61
R5572:Snx13	UTSW	12	35,153,119 (GRCm39)	missense	probably damaging	1.00
R5635:Snx13	UTSW	12	35,190,170 (GRCm39)	missense	probably benign	0.00
R6018:Snx13	UTSW	12	35,097,318 (GRCm39)	start gained	probably benign
R6612:Snx13	UTSW	12	35,156,758 (GRCm39)	missense	probably benign	0.19
R6618:Snx13	UTSW	12	35,162,444 (GRCm39)	missense	probably damaging	1.00
R6737:Snx13	UTSW	12	35,190,185 (GRCm39)	missense	probably damaging	0.98
R6964:Snx13	UTSW	12	35,169,788 (GRCm39)	missense	possibly damaging	0.81
R7186:Snx13	UTSW	12	35,142,912 (GRCm39)	missense	probably damaging	0.99
R7372:Snx13	UTSW	12	35,128,950 (GRCm39)	missense	probably benign	0.00
R7429:Snx13	UTSW	12	35,183,357 (GRCm39)	missense	possibly damaging	0.89
R7430:Snx13	UTSW	12	35,183,357 (GRCm39)	missense	possibly damaging	0.89
R7537:Snx13	UTSW	12	35,135,981 (GRCm39)	missense	probably damaging	1.00
R7567:Snx13	UTSW	12	35,136,913 (GRCm39)	missense	probably damaging	1.00
R7582:Snx13	UTSW	12	35,174,534 (GRCm39)	nonsense	probably null
R7767:Snx13	UTSW	12	35,157,483 (GRCm39)	missense	probably damaging	1.00
R7771:Snx13	UTSW	12	35,174,527 (GRCm39)	missense	probably benign
R7838:Snx13	UTSW	12	35,155,174 (GRCm39)	missense	probably benign	0.26
R7901:Snx13	UTSW	12	35,150,624 (GRCm39)	missense	probably benign	0.02
R8029:Snx13	UTSW	12	35,169,885 (GRCm39)	missense	probably damaging	1.00
R8418:Snx13	UTSW	12	35,148,233 (GRCm39)	missense	probably damaging	1.00
R8961:Snx13	UTSW	12	35,155,285 (GRCm39)	missense	probably damaging	1.00
R9197:Snx13	UTSW	12	35,155,196 (GRCm39)	missense	probably benign	0.00
R9372:Snx13	UTSW	12	35,151,048 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGGAATCTGTTTTATCCTTTGCTGC -3'
(R):5'- TCCTTAGAGAAATGTAGGCTCAGAG -3'

Sequencing Primer
(F):5'- GCTGCCGTTCTTTTGTCTCTG -3'
(R):5'- ATGTAGGCTCAGAGCTGAAC -3'

Posted On

2014-11-11