Incidental Mutation 'R2386:Pmepa1'
ID247692
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Nameprostate transmembrane protein, androgen induced 1
SynonymsN4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2386 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173224458-173276533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173228133 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 210 (R210W)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
Predicted Effect probably damaging
Transcript: ENSMUST00000036248
AA Change: R172W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: R172W

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124124
Predicted Effect probably damaging
Transcript: ENSMUST00000139306
AA Change: R210W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: R210W

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,437,749 D2G probably damaging Het
Btnl9 A G 11: 49,178,775 S226P probably damaging Het
Canx A T 11: 50,297,106 D558E probably benign Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Col1a1 A T 11: 94,950,391 D1200V unknown Het
Dgat2 A C 7: 99,157,093 V299G possibly damaging Het
Ercc6 G A 14: 32,541,359 probably null Het
Fgfr4 T C 13: 55,167,901 V747A probably benign Het
Ftcd A C 10: 76,581,377 D240A probably damaging Het
Hs3st3b1 C A 11: 63,889,213 E363* probably null Het
Ikbke A G 1: 131,259,266 L563P probably damaging Het
Lbhd2 A T 12: 111,410,307 T63S possibly damaging Het
Mterf1a A T 5: 3,891,225 D214E probably benign Het
Olfr473 A G 7: 107,934,273 Y251C probably damaging Het
Pclo A G 5: 14,765,247 E4511G unknown Het
Pigs A G 11: 78,332,986 Y108C probably damaging Het
Pkhd1l1 A G 15: 44,528,178 T1547A probably benign Het
Rad54b T A 4: 11,597,874 M253K probably benign Het
Rrp12 T C 19: 41,871,284 D1080G probably benign Het
Sox6 A G 7: 115,597,505 Y298H probably damaging Het
Tdrd9 A T 12: 112,015,900 D475V probably damaging Het
Tmem131 G A 1: 36,829,635 H370Y probably benign Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173228575 critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173228081 missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173234360 missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173228327 missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173228322 missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173234312 missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173234419 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAATGACCTCGCTGTAGGTG -3'
(R):5'- GAATCCAACCTCAGTCTGCCTC -3'

Sequencing Primer
(F):5'- GATGCCCGAGTTACTGC -3'
(R):5'- TCCAGCCACAGGTCTATGC -3'
Posted On2014-11-11