Incidental Mutation 'R2386:Canx'
ID247703
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Namecalnexin
Synonyms1110069N15Rik, CNX
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R2386 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50293961-50325673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50297106 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 558 (D558E)
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000059458] [ENSMUST00000179865]
Predicted Effect probably benign
Transcript: ENSMUST00000020637
AA Change: D558E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: D558E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059458
SMART Domains Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567

DomainStartEndE-ValueType
MamL-1 14 73 1.04e-32 SMART
low complexity region 77 102 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 588 600 N/A INTRINSIC
coiled coil region 627 671 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155801
Predicted Effect probably benign
Transcript: ENSMUST00000179865
AA Change: D558E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: D558E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,437,749 D2G probably damaging Het
Btnl9 A G 11: 49,178,775 S226P probably damaging Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Col1a1 A T 11: 94,950,391 D1200V unknown Het
Dgat2 A C 7: 99,157,093 V299G possibly damaging Het
Ercc6 G A 14: 32,541,359 probably null Het
Fgfr4 T C 13: 55,167,901 V747A probably benign Het
Ftcd A C 10: 76,581,377 D240A probably damaging Het
Hs3st3b1 C A 11: 63,889,213 E363* probably null Het
Ikbke A G 1: 131,259,266 L563P probably damaging Het
Lbhd2 A T 12: 111,410,307 T63S possibly damaging Het
Mterf1a A T 5: 3,891,225 D214E probably benign Het
Olfr473 A G 7: 107,934,273 Y251C probably damaging Het
Pclo A G 5: 14,765,247 E4511G unknown Het
Pigs A G 11: 78,332,986 Y108C probably damaging Het
Pkhd1l1 A G 15: 44,528,178 T1547A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Rad54b T A 4: 11,597,874 M253K probably benign Het
Rrp12 T C 19: 41,871,284 D1080G probably benign Het
Sox6 A G 7: 115,597,505 Y298H probably damaging Het
Tdrd9 A T 12: 112,015,900 D475V probably damaging Het
Tmem131 G A 1: 36,829,635 H370Y probably benign Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1428:Canx UTSW 11 50308394 splice site probably benign
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2217:Canx UTSW 11 50310867 missense probably benign 0.24
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5797:Canx UTSW 11 50301017 missense probably benign 0.00
R5820:Canx UTSW 11 50308383 missense probably damaging 1.00
R6052:Canx UTSW 11 50297119 missense possibly damaging 0.49
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAACATGTACTTTCCCTAAACCT -3'
(R):5'- GTGAGCGGAGTCTAGAAACCT -3'

Sequencing Primer
(F):5'- CTGAGAATTGAATCCAGGTGCTC -3'
(R):5'- GCGGAGTCTAGAAACCTGTCATAAAC -3'
Posted On2014-11-11