Incidental Mutation 'R2386:Hs3st3b1'
ID247704
Institutional Source Beutler Lab
Gene Symbol Hs3st3b1
Ensembl Gene ENSMUSG00000070407
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms3OST3B1, m3-OST-3B, 3-OST-3B, HS3ST3B1, 3Ost3b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2386 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location63885792-63922290 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 63889213 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 363 (E363*)
Ref Sequence ENSEMBL: ENSMUSP00000091647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094103]
Predicted Effect probably null
Transcript: ENSMUST00000094103
AA Change: E363*
SMART Domains Protein: ENSMUSP00000091647
Gene: ENSMUSG00000070407
AA Change: E363*

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 6 318 1.7e-11 PFAM
Pfam:Sulfotransfer_1 137 383 6.3e-48 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II integral membrane protein that belongs to the 3-O-sulfotransferases family. These proteins catalyze the addition of sulfate groups at the 3-OH position of glucosamine in heparan sulfate. The substrate specificity of individual members of the family is based on prior modification of the heparan sulfate chain, thus allowing different members of the family to generate binding sites for different proteins on the same heparan sulfate chain. Following treatment with a histone deacetylase inhibitor, expression of this gene is activated in a pancreatic cell line. The increased expression results in promotion of the epithelial-mesenchymal transition. In addition, the modification catalyzed by this protein allows herpes simplex virus membrane fusion and penetration. A very closely related homolog with an almost identical sulfotransferase domain maps less than 1 Mb away. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,437,749 D2G probably damaging Het
Btnl9 A G 11: 49,178,775 S226P probably damaging Het
Canx A T 11: 50,297,106 D558E probably benign Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Col1a1 A T 11: 94,950,391 D1200V unknown Het
Dgat2 A C 7: 99,157,093 V299G possibly damaging Het
Ercc6 G A 14: 32,541,359 probably null Het
Fgfr4 T C 13: 55,167,901 V747A probably benign Het
Ftcd A C 10: 76,581,377 D240A probably damaging Het
Ikbke A G 1: 131,259,266 L563P probably damaging Het
Lbhd2 A T 12: 111,410,307 T63S possibly damaging Het
Mterf1a A T 5: 3,891,225 D214E probably benign Het
Olfr473 A G 7: 107,934,273 Y251C probably damaging Het
Pclo A G 5: 14,765,247 E4511G unknown Het
Pigs A G 11: 78,332,986 Y108C probably damaging Het
Pkhd1l1 A G 15: 44,528,178 T1547A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Rad54b T A 4: 11,597,874 M253K probably benign Het
Rrp12 T C 19: 41,871,284 D1080G probably benign Het
Sox6 A G 7: 115,597,505 Y298H probably damaging Het
Tdrd9 A T 12: 112,015,900 D475V probably damaging Het
Tmem131 G A 1: 36,829,635 H370Y probably benign Het
Other mutations in Hs3st3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0723:Hs3st3b1 UTSW 11 63921575 missense probably benign
R1940:Hs3st3b1 UTSW 11 63889743 missense probably benign 0.01
R4784:Hs3st3b1 UTSW 11 63889260 missense probably benign 0.21
R5771:Hs3st3b1 UTSW 11 63889272 missense probably benign 0.00
R6102:Hs3st3b1 UTSW 11 63921855 nonsense probably null
R6153:Hs3st3b1 UTSW 11 63889498 missense probably damaging 0.98
R6191:Hs3st3b1 UTSW 11 63889203 missense probably benign 0.00
R6525:Hs3st3b1 UTSW 11 63921598 missense probably benign
R7282:Hs3st3b1 UTSW 11 63921571 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGCAGATTGTGGCTAGG -3'
(R):5'- TCATAGACACGTCCTGGAGC -3'

Sequencing Primer
(F):5'- GCTAGGCAGCTTAGTGAATTAATTGC -3'
(R):5'- ATCCAGATCGGCCTGTACG -3'
Posted On2014-11-11