Incidental Mutation 'R2392:Lrrc45'
ID247824
Institutional Source Beutler Lab
Gene Symbol Lrrc45
Ensembl Gene ENSMUSG00000025145
Gene Nameleucine rich repeat containing 45
Synonyms
MMRRC Submission 040360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2392 (G1)
Quality Score223
Status Validated
Chromosome11
Chromosomal Location120713925-120721128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120719539 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 492 (N492S)
Ref Sequence ENSEMBL: ENSMUSP00000026139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026139] [ENSMUST00000142229] [ENSMUST00000145781] [ENSMUST00000151852]
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026139
AA Change: N492S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145
AA Change: N492S

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134322
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145781
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150225
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155187
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,258,105 S2409T probably damaging Het
Acap2 A G 16: 31,139,640 F120S probably damaging Het
Akr1c6 A G 13: 4,434,478 probably null Het
Bptf C A 11: 107,072,747 A1874S probably damaging Het
Ccnl1 A G 3: 65,948,752 V244A probably damaging Het
Cenpe T G 3: 135,248,113 L1628R probably damaging Het
Cfap54 A G 10: 93,025,011 probably null Het
Chchd7 T A 4: 3,943,381 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crybg2 G T 4: 134,072,614 V362L probably benign Het
Ddx11 T A 17: 66,149,973 V791E probably damaging Het
Disp1 G A 1: 183,087,167 P1230S probably benign Het
Elp5 T C 11: 69,975,102 H116R probably benign Het
Epb42 T C 2: 121,029,987 E177G possibly damaging Het
F13a1 T A 13: 36,943,997 I336F possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fuk A G 8: 110,889,724 M453T probably benign Het
Hacd2 A T 16: 35,106,378 E249V probably benign Het
Hnrnpf C A 6: 117,924,868 A371D possibly damaging Het
Jmjd1c A G 10: 67,229,904 T1703A probably damaging Het
Kcnj13 G A 1: 87,386,900 T200I possibly damaging Het
Kif1b G A 4: 149,220,620 T949M possibly damaging Het
Klhl35 G A 7: 99,473,824 A552T possibly damaging Het
Krt74 A G 15: 101,756,801 noncoding transcript Het
Krtap14 T A 16: 88,825,709 probably null Het
Lrrcc1 T A 3: 14,536,520 N114K probably damaging Het
Mfsd2b T C 12: 4,865,164 D375G possibly damaging Het
Mgat4a A G 1: 37,498,704 L44P probably damaging Het
Mttp A C 3: 138,095,021 D774E probably damaging Het
Myo5a T C 9: 75,209,239 V1554A probably benign Het
Nes C T 3: 87,975,943 A503V probably benign Het
Nme8 A G 13: 19,688,943 probably null Het
Nr4a1 A G 15: 101,274,194 D583G possibly damaging Het
Olfr109 A G 17: 37,466,419 Y71C probably damaging Het
Olfr177 A G 16: 58,872,434 S239P probably damaging Het
Pnpla8 T A 12: 44,311,504 L746I probably damaging Het
Ppp1r7 A T 1: 93,354,341 I205F probably benign Het
Psd4 C A 2: 24,394,667 P181Q probably damaging Het
Ripor2 G A 13: 24,706,223 V694I probably benign Het
Scn10a A G 9: 119,627,202 S1185P possibly damaging Het
Sec23b T A 2: 144,585,587 probably null Het
Slfn2 A G 11: 83,065,328 N12S possibly damaging Het
Slfn4 A G 11: 83,185,422 K38R possibly damaging Het
Smarca2 G T 19: 26,640,650 probably null Het
Taar4 A G 10: 23,961,274 T261A possibly damaging Het
Tbl2 A G 5: 135,156,514 D159G probably benign Het
Tmem120a T C 5: 135,742,038 E55G probably damaging Het
Ttc21b A G 2: 66,207,450 probably null Het
Vill A T 9: 119,067,560 probably benign Het
Vmn2r28 A T 7: 5,484,131 M511K probably damaging Het
Vmn2r81 A T 10: 79,274,682 D543V probably damaging Het
Wdr95 A G 5: 149,580,670 T314A probably benign Het
Zbtb8b A G 4: 129,433,189 I61T probably damaging Het
Other mutations in Lrrc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Lrrc45 APN 11 120720610 splice site probably benign
IGL01120:Lrrc45 APN 11 120720010 missense probably benign
IGL01536:Lrrc45 APN 11 120715584 missense probably benign 0.01
IGL01839:Lrrc45 APN 11 120717149 unclassified probably null
IGL02190:Lrrc45 APN 11 120718508 missense probably damaging 0.99
IGL02302:Lrrc45 APN 11 120718525 missense possibly damaging 0.68
IGL02724:Lrrc45 APN 11 120718318 missense probably benign 0.25
R0396:Lrrc45 UTSW 11 120714907 splice site probably benign
R0420:Lrrc45 UTSW 11 120715219 missense probably damaging 1.00
R0540:Lrrc45 UTSW 11 120715162 nonsense probably null
R0833:Lrrc45 UTSW 11 120718193 unclassified probably null
R0942:Lrrc45 UTSW 11 120718238 unclassified probably benign
R1252:Lrrc45 UTSW 11 120715471 missense probably benign 0.13
R1426:Lrrc45 UTSW 11 120720013 missense probably benign 0.00
R1543:Lrrc45 UTSW 11 120720018 missense probably benign 0.06
R1570:Lrrc45 UTSW 11 120720109 critical splice donor site probably null
R3000:Lrrc45 UTSW 11 120718447 missense probably benign 0.00
R3930:Lrrc45 UTSW 11 120718677 missense probably benign 0.06
R4158:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4161:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4432:Lrrc45 UTSW 11 120715221 critical splice donor site probably null
R4647:Lrrc45 UTSW 11 120719121 missense probably benign 0.02
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6220:Lrrc45 UTSW 11 120719527 missense probably benign 0.37
X0026:Lrrc45 UTSW 11 120720232 missense probably damaging 1.00
Z1088:Lrrc45 UTSW 11 120720231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAGAAGTTTCCCCAGC -3'
(R):5'- GTCGACTCTATGTCAGCTCTAC -3'

Sequencing Primer
(F):5'- AGAAGTTTCCCCAGCCTGGC -3'
(R):5'- GACTCTATGTCAGCTCTACTAACTC -3'
Posted On2014-11-11