Incidental Mutation 'R2393:Col9a2'
ID247849
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Namecollagen, type IX, alpha 2
SynonymsCol9a-2
MMRRC Submission 040361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2393 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121039385-121055322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 121054258 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 599 (R599G)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058754
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,057 L512* probably null Het
Adam4 A T 12: 81,420,711 F379I probably benign Het
Ano6 C G 15: 95,966,025 probably benign Het
Apc2 A G 10: 80,313,069 E1319G possibly damaging Het
Arfgef3 A G 10: 18,597,787 V1588A possibly damaging Het
Arl8a T A 1: 135,152,866 V93E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd200r2 T A 16: 44,909,267 I95N probably damaging Het
Cd209d A G 8: 3,878,436 probably null Het
Cep290 A G 10: 100,561,238 probably null Het
Chd2 G T 7: 73,507,883 D171E possibly damaging Het
Chrna7 G A 7: 63,099,246 A496V probably damaging Het
Colgalt1 C G 8: 71,623,741 T612S probably benign Het
Copg2 T C 6: 30,810,958 K602E probably benign Het
Crtc1 T A 8: 70,388,158 T473S probably benign Het
Ctbp2 A T 7: 133,023,561 probably null Het
Edem1 T G 6: 108,852,543 M541R probably damaging Het
Ehmt1 A C 2: 24,806,217 V953G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr2 T C 7: 130,227,238 probably null Het
Focad A G 4: 88,121,330 D10G probably damaging Het
Gm5901 G T 7: 105,377,789 V255F possibly damaging Het
Hsp90aa1 T C 12: 110,693,406 N416S probably damaging Het
Hspb1 T C 5: 135,889,096 F142L probably benign Het
Il17re C T 6: 113,462,353 H75Y possibly damaging Het
Kctd3 A G 1: 188,981,371 I389T probably damaging Het
Lhx6 T C 2: 36,091,390 D63G probably benign Het
Mepe A G 5: 104,337,461 T156A possibly damaging Het
Met A G 6: 17,534,198 Y680C probably damaging Het
Mrgpra3 T C 7: 47,589,617 Y187C possibly damaging Het
Mst1 T G 9: 108,082,952 probably null Het
Myh13 T A 11: 67,340,358 S394T possibly damaging Het
Nbeal1 T A 1: 60,251,370 V1042E probably damaging Het
Ndrg4 T A 8: 95,706,211 Y15* probably null Het
Neurl4 G A 11: 69,907,074 R720H probably damaging Het
Nfkbia A G 12: 55,490,670 probably benign Het
Nwd1 T A 8: 72,662,427 M202K probably benign Het
Olfr332 T A 11: 58,490,720 I12F probably benign Het
Olfr963 G T 9: 39,669,273 C72F possibly damaging Het
Pate2 T C 9: 35,669,740 probably benign Het
Pibf1 A G 14: 99,242,932 T715A probably benign Het
Pitpnm1 T C 19: 4,110,935 L858P probably benign Het
Pla2g3 A C 11: 3,493,115 S483R probably benign Het
Rad51ap2 T A 12: 11,457,797 D573E probably damaging Het
Rho T C 6: 115,935,391 probably benign Het
Rpl39l A T 16: 10,174,464 *52L probably null Het
Slco1a5 T A 6: 142,248,775 R381W possibly damaging Het
Spns3 T A 11: 72,550,233 probably benign Het
Srgap2 A G 1: 131,332,134 S493P probably benign Het
Tecpr2 T C 12: 110,926,402 S293P probably damaging Het
Tsta3 G T 15: 75,926,351 L191I probably damaging Het
Ttn C T 2: 76,752,867 V20815M probably benign Het
Ushbp1 T C 8: 71,394,488 I167V probably benign Het
Wdr81 C T 11: 75,449,405 A1296T probably damaging Het
Zmym2 A G 14: 56,920,723 Y573C probably benign Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
Predicted Primers PCR Primer
(F):5'- AACCTCCCAAATCTTATCTGGATC -3'
(R):5'- TCAAGAGTCCCAACTGCCAG -3'

Sequencing Primer
(F):5'- ATCTGGATCTCCCTTTATCTAACCAG -3'
(R):5'- AGAGACACCTCCAGCTTGG -3'
Posted On2014-11-11