Incidental Mutation 'R2393:Chrna7'
ID 247861
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms alpha7 nicotinic receptor, alpha7, alpha7-nAChR, Acra7
MMRRC Submission 040361-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2393 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 62748440-62862274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 62748994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 496 (A496V)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
AlphaFold P49582
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: A496V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: A496V

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Meta Mutation Damage Score 0.1193 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,225,057 (GRCm39) L512* probably null Het
Adam4 A T 12: 81,467,485 (GRCm39) F379I probably benign Het
Ano6 C G 15: 95,863,906 (GRCm39) probably benign Het
Apc2 A G 10: 80,148,903 (GRCm39) E1319G possibly damaging Het
Arfgef3 A G 10: 18,473,535 (GRCm39) V1588A possibly damaging Het
Arl8a T A 1: 135,080,604 (GRCm39) V93E probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Cd200r2 T A 16: 44,729,630 (GRCm39) I95N probably damaging Het
Cd209d A G 8: 3,928,436 (GRCm39) probably null Het
Cep290 A G 10: 100,397,100 (GRCm39) probably null Het
Chd2 G T 7: 73,157,631 (GRCm39) D171E possibly damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Colgalt1 C G 8: 72,076,385 (GRCm39) T612S probably benign Het
Copg2 T C 6: 30,787,893 (GRCm39) K602E probably benign Het
Crtc1 T A 8: 70,840,808 (GRCm39) T473S probably benign Het
Ctbp2 A T 7: 132,625,290 (GRCm39) probably null Het
Edem1 T G 6: 108,829,504 (GRCm39) M541R probably damaging Het
Ehmt1 A C 2: 24,696,229 (GRCm39) V953G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fgfr2 T C 7: 129,828,968 (GRCm39) probably null Het
Focad A G 4: 88,039,567 (GRCm39) D10G probably damaging Het
Gfus G T 15: 75,798,200 (GRCm39) L191I probably damaging Het
Gm5901 G T 7: 105,026,996 (GRCm39) V255F possibly damaging Het
Hsp90aa1 T C 12: 110,659,840 (GRCm39) N416S probably damaging Het
Hspb1 T C 5: 135,917,950 (GRCm39) F142L probably benign Het
Il17re C T 6: 113,439,314 (GRCm39) H75Y possibly damaging Het
Kctd3 A G 1: 188,713,568 (GRCm39) I389T probably damaging Het
Lhx6 T C 2: 35,981,402 (GRCm39) D63G probably benign Het
Mepe A G 5: 104,485,327 (GRCm39) T156A possibly damaging Het
Met A G 6: 17,534,197 (GRCm39) Y680C probably damaging Het
Mrgpra3 T C 7: 47,239,365 (GRCm39) Y187C possibly damaging Het
Mst1 T G 9: 107,960,151 (GRCm39) probably null Het
Myh13 T A 11: 67,231,184 (GRCm39) S394T possibly damaging Het
Nbeal1 T A 1: 60,290,529 (GRCm39) V1042E probably damaging Het
Ndrg4 T A 8: 96,432,839 (GRCm39) Y15* probably null Het
Neurl4 G A 11: 69,797,900 (GRCm39) R720H probably damaging Het
Nfkbia A G 12: 55,537,455 (GRCm39) probably benign Het
Nwd1 T A 8: 73,389,055 (GRCm39) M202K probably benign Het
Or10d4 G T 9: 39,580,569 (GRCm39) C72F possibly damaging Het
Or2av9 T A 11: 58,381,546 (GRCm39) I12F probably benign Het
Pate2 T C 9: 35,581,036 (GRCm39) probably benign Het
Pibf1 A G 14: 99,480,368 (GRCm39) T715A probably benign Het
Pitpnm1 T C 19: 4,160,935 (GRCm39) L858P probably benign Het
Pla2g3 A C 11: 3,443,115 (GRCm39) S483R probably benign Het
Rad51ap2 T A 12: 11,507,798 (GRCm39) D573E probably damaging Het
Rho T C 6: 115,912,352 (GRCm39) probably benign Het
Rpl39l A T 16: 9,992,328 (GRCm39) *52L probably null Het
Slco1a5 T A 6: 142,194,501 (GRCm39) R381W possibly damaging Het
Spns3 T A 11: 72,441,059 (GRCm39) probably benign Het
Srgap2 A G 1: 131,259,872 (GRCm39) S493P probably benign Het
Tecpr2 T C 12: 110,892,836 (GRCm39) S293P probably damaging Het
Ttn C T 2: 76,583,211 (GRCm39) V20815M probably benign Het
Ushbp1 T C 8: 71,847,132 (GRCm39) I167V probably benign Het
Wdr81 C T 11: 75,340,231 (GRCm39) A1296T probably damaging Het
Zmym2 A G 14: 57,158,180 (GRCm39) Y573C probably benign Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 62,749,267 (GRCm39) missense probably benign 0.01
IGL01999:Chrna7 APN 7 62,753,539 (GRCm39) missense probably damaging 1.00
IGL02016:Chrna7 APN 7 62,753,583 (GRCm39) missense probably damaging 1.00
IGL02388:Chrna7 APN 7 62,757,439 (GRCm39) missense probably damaging 1.00
IGL02400:Chrna7 APN 7 62,749,070 (GRCm39) missense probably damaging 1.00
IGL02458:Chrna7 APN 7 62,755,842 (GRCm39) missense probably damaging 1.00
IGL03039:Chrna7 APN 7 62,798,340 (GRCm39) missense probably damaging 1.00
inflation UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
thaler UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R0034:Chrna7 UTSW 7 62,798,354 (GRCm39) missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 62,749,391 (GRCm39) missense probably benign 0.00
R1666:Chrna7 UTSW 7 62,861,890 (GRCm39) missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 62,749,255 (GRCm39) missense probably damaging 0.99
R1763:Chrna7 UTSW 7 62,749,000 (GRCm39) missense probably benign 0.05
R1974:Chrna7 UTSW 7 62,749,034 (GRCm39) missense probably damaging 1.00
R2294:Chrna7 UTSW 7 62,760,172 (GRCm39) missense probably benign 0.11
R4598:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4599:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4842:Chrna7 UTSW 7 62,862,196 (GRCm39) missense probably benign 0.05
R5143:Chrna7 UTSW 7 62,755,895 (GRCm39) missense probably damaging 1.00
R5310:Chrna7 UTSW 7 62,755,805 (GRCm39) missense probably damaging 1.00
R5339:Chrna7 UTSW 7 62,749,055 (GRCm39) missense probably damaging 1.00
R5516:Chrna7 UTSW 7 62,749,046 (GRCm39) missense probably damaging 0.98
R5807:Chrna7 UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
R6501:Chrna7 UTSW 7 62,755,863 (GRCm39) missense probably damaging 1.00
R6918:Chrna7 UTSW 7 62,809,299 (GRCm39) missense probably benign 0.03
R7000:Chrna7 UTSW 7 62,755,787 (GRCm39) missense probably damaging 1.00
R7189:Chrna7 UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R7483:Chrna7 UTSW 7 62,754,738 (GRCm39) missense probably damaging 1.00
R7953:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7955:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7956:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R8235:Chrna7 UTSW 7 62,861,972 (GRCm39) missense probably damaging 1.00
R9125:Chrna7 UTSW 7 62,757,357 (GRCm39) nonsense probably null
R9356:Chrna7 UTSW 7 62,757,437 (GRCm39) missense probably damaging 1.00
R9694:Chrna7 UTSW 7 62,754,809 (GRCm39) missense probably damaging 1.00
Z1176:Chrna7 UTSW 7 62,861,932 (GRCm39) missense probably damaging 1.00
Z1177:Chrna7 UTSW 7 62,757,299 (GRCm39) critical splice donor site probably null
Z1191:Chrna7 UTSW 7 62,755,941 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TAAACAGAAGCTGCTGGGATC -3'
(R):5'- TGGTACACACCCCTCTGATG -3'

Sequencing Primer
(F):5'- AACAGAAGCTGCTGGGATCTTTTTAG -3'
(R):5'- ACCTGGCCAAGATCCTGGAG -3'
Posted On 2014-11-11