Incidental Mutation 'R2393:Crtc1'
ID247867
Institutional Source Beutler Lab
Gene Symbol Crtc1
Ensembl Gene ENSMUSG00000003575
Gene NameCREB regulated transcription coactivator 1
SynonymsMect1, TORC1
MMRRC Submission 040361-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R2393 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70382355-70439579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70388158 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 473 (T473S)
Ref Sequence ENSEMBL: ENSMUSP00000075916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076615]
Predicted Effect probably benign
Transcript: ENSMUST00000076615
AA Change: T473S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575
AA Change: T473S

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142769
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating mutation in this gene are hyperphagic, obese and infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,057 L512* probably null Het
Adam4 A T 12: 81,420,711 F379I probably benign Het
Ano6 C G 15: 95,966,025 probably benign Het
Apc2 A G 10: 80,313,069 E1319G possibly damaging Het
Arfgef3 A G 10: 18,597,787 V1588A possibly damaging Het
Arl8a T A 1: 135,152,866 V93E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd200r2 T A 16: 44,909,267 I95N probably damaging Het
Cd209d A G 8: 3,878,436 probably null Het
Cep290 A G 10: 100,561,238 probably null Het
Chd2 G T 7: 73,507,883 D171E possibly damaging Het
Chrna7 G A 7: 63,099,246 A496V probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Colgalt1 C G 8: 71,623,741 T612S probably benign Het
Copg2 T C 6: 30,810,958 K602E probably benign Het
Ctbp2 A T 7: 133,023,561 probably null Het
Edem1 T G 6: 108,852,543 M541R probably damaging Het
Ehmt1 A C 2: 24,806,217 V953G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgfr2 T C 7: 130,227,238 probably null Het
Focad A G 4: 88,121,330 D10G probably damaging Het
Gm5901 G T 7: 105,377,789 V255F possibly damaging Het
Hsp90aa1 T C 12: 110,693,406 N416S probably damaging Het
Hspb1 T C 5: 135,889,096 F142L probably benign Het
Il17re C T 6: 113,462,353 H75Y possibly damaging Het
Kctd3 A G 1: 188,981,371 I389T probably damaging Het
Lhx6 T C 2: 36,091,390 D63G probably benign Het
Mepe A G 5: 104,337,461 T156A possibly damaging Het
Met A G 6: 17,534,198 Y680C probably damaging Het
Mrgpra3 T C 7: 47,589,617 Y187C possibly damaging Het
Mst1 T G 9: 108,082,952 probably null Het
Myh13 T A 11: 67,340,358 S394T possibly damaging Het
Nbeal1 T A 1: 60,251,370 V1042E probably damaging Het
Ndrg4 T A 8: 95,706,211 Y15* probably null Het
Neurl4 G A 11: 69,907,074 R720H probably damaging Het
Nfkbia A G 12: 55,490,670 probably benign Het
Nwd1 T A 8: 72,662,427 M202K probably benign Het
Olfr332 T A 11: 58,490,720 I12F probably benign Het
Olfr963 G T 9: 39,669,273 C72F possibly damaging Het
Pate2 T C 9: 35,669,740 probably benign Het
Pibf1 A G 14: 99,242,932 T715A probably benign Het
Pitpnm1 T C 19: 4,110,935 L858P probably benign Het
Pla2g3 A C 11: 3,493,115 S483R probably benign Het
Rad51ap2 T A 12: 11,457,797 D573E probably damaging Het
Rho T C 6: 115,935,391 probably benign Het
Rpl39l A T 16: 10,174,464 *52L probably null Het
Slco1a5 T A 6: 142,248,775 R381W possibly damaging Het
Spns3 T A 11: 72,550,233 probably benign Het
Srgap2 A G 1: 131,332,134 S493P probably benign Het
Tecpr2 T C 12: 110,926,402 S293P probably damaging Het
Tsta3 G T 15: 75,926,351 L191I probably damaging Het
Ttn C T 2: 76,752,867 V20815M probably benign Het
Ushbp1 T C 8: 71,394,488 I167V probably benign Het
Wdr81 C T 11: 75,449,405 A1296T probably damaging Het
Zmym2 A G 14: 56,920,723 Y573C probably benign Het
Other mutations in Crtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Crtc1 APN 8 70439522 missense probably benign 0.01
IGL01361:Crtc1 APN 8 70387603 missense probably damaging 1.00
IGL02883:Crtc1 APN 8 70406125 missense probably benign 0.28
R0049:Crtc1 UTSW 8 70391859 critical splice donor site probably null
R0196:Crtc1 UTSW 8 70386221 missense probably damaging 1.00
R0514:Crtc1 UTSW 8 70402429 critical splice donor site probably null
R0588:Crtc1 UTSW 8 70439549 missense probably damaging 0.99
R0744:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0833:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0836:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0905:Crtc1 UTSW 8 70391255 missense probably damaging 1.00
R1016:Crtc1 UTSW 8 70392119 nonsense probably null
R1300:Crtc1 UTSW 8 70387539 critical splice donor site probably null
R1533:Crtc1 UTSW 8 70398299 missense probably damaging 1.00
R1843:Crtc1 UTSW 8 70388152 missense probably benign 0.00
R4867:Crtc1 UTSW 8 70402514 missense probably damaging 1.00
R5339:Crtc1 UTSW 8 70397733 splice site probably benign
R6062:Crtc1 UTSW 8 70406189 missense probably damaging 1.00
R6342:Crtc1 UTSW 8 70439557 start codon destroyed probably null 0.95
R6912:Crtc1 UTSW 8 70398311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATCATCCTTCCAGGGC -3'
(R):5'- TCAGGCTCTAGGGGAGTAGATG -3'

Sequencing Primer
(F):5'- AGGGCCTTTGCTTCCACAG -3'
(R):5'- CTTTGGGGAGCATAGAGGCC -3'
Posted On2014-11-11