Incidental Mutation 'R2394:Olfml2b'
ID247899
Institutional Source Beutler Lab
Gene Symbol Olfml2b
Ensembl Gene ENSMUSG00000038463
Gene Nameolfactomedin-like 2B
Synonymsphotomedin-2, 1110018N05Rik, 4832415H08Rik
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170644532-170682789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170649750 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 151 (I151M)
Ref Sequence ENSEMBL: ENSMUSP00000047291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046792
AA Change: I151M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047291
Gene: ENSMUSG00000038463
AA Change: I151M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 41 68 N/A INTRINSIC
coiled coil region 179 213 N/A INTRINSIC
low complexity region 233 238 N/A INTRINSIC
Blast:OLF 254 306 1e-6 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 343 382 N/A INTRINSIC
OLF 492 746 4.76e-61 SMART
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an olfactomedin domain-containing protein. Most olfactomedin domain-containing proteins are secreted glycoproteins. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Olfml2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Olfml2b APN 1 170669066 missense probably damaging 0.96
IGL01871:Olfml2b APN 1 170662355 splice site probably benign
IGL02475:Olfml2b APN 1 170682174 missense probably damaging 1.00
IGL02657:Olfml2b APN 1 170681076 missense probably benign 0.00
IGL03375:Olfml2b APN 1 170649832 missense probably benign 0.35
PIT4280001:Olfml2b UTSW 1 170647736 missense probably damaging 1.00
R0040:Olfml2b UTSW 1 170668751 missense probably benign 0.00
R0194:Olfml2b UTSW 1 170681115 missense possibly damaging 0.89
R0834:Olfml2b UTSW 1 170647844 missense probably benign 0.00
R1218:Olfml2b UTSW 1 170649782 missense probably damaging 1.00
R1386:Olfml2b UTSW 1 170681162 missense probably damaging 0.97
R1420:Olfml2b UTSW 1 170669027 missense probably benign 0.01
R1699:Olfml2b UTSW 1 170645073 missense possibly damaging 0.89
R1730:Olfml2b UTSW 1 170681789 missense probably damaging 1.00
R1755:Olfml2b UTSW 1 170681777 missense probably damaging 1.00
R1869:Olfml2b UTSW 1 170669243 missense probably damaging 0.96
R2295:Olfml2b UTSW 1 170662538 splice site probably benign
R3784:Olfml2b UTSW 1 170681982 missense probably damaging 0.96
R4523:Olfml2b UTSW 1 170669222 missense probably benign
R4611:Olfml2b UTSW 1 170644947 missense probably damaging 0.99
R4900:Olfml2b UTSW 1 170662378 missense probably damaging 1.00
R5201:Olfml2b UTSW 1 170668864 missense probably benign
R5245:Olfml2b UTSW 1 170668874 missense probably benign
R5268:Olfml2b UTSW 1 170649761 missense probably damaging 1.00
R5283:Olfml2b UTSW 1 170681189 nonsense probably null
R5348:Olfml2b UTSW 1 170662426 missense probably benign 0.02
R5408:Olfml2b UTSW 1 170644976 missense probably damaging 1.00
R5673:Olfml2b UTSW 1 170682129 missense probably damaging 1.00
R5758:Olfml2b UTSW 1 170669264 critical splice donor site probably null
R5893:Olfml2b UTSW 1 170662473 missense probably benign
R6290:Olfml2b UTSW 1 170649790 nonsense probably null
R6380:Olfml2b UTSW 1 170669231 missense probably benign 0.00
R6778:Olfml2b UTSW 1 170645070 missense probably damaging 1.00
R7155:Olfml2b UTSW 1 170666785 missense probably benign 0.01
R7538:Olfml2b UTSW 1 170649833 missense not run
Predicted Primers PCR Primer
(F):5'- AATACATATCACAGCTGGGGCC -3'
(R):5'- CAGTCAATAGCACCAGTCCATG -3'

Sequencing Primer
(F):5'- GGGGCCTGTCTAAGTCCTTC -3'
(R):5'- GGACTTCTTCCAGTAGAGCTG -3'
Posted On2014-11-11