Incidental Mutation 'R2394:Ripk2'
ID247902
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Namereceptor (TNFRSF)-interacting serine-threonine kinase 2
SynonymsCCK, RICK, CARD3, D4Bwg0615e, 2210420D18Rik, RIP2, CARDIAK
MMRRC Submission 040362-MU
Accession Numbers

Ncbi RefSeq: NM_138952.3; MGI:1891456

Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location16122733-16163647 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 16132774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
Predicted Effect probably benign
Transcript: ENSMUST00000037035
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175054
Predicted Effect probably benign
Transcript: ENSMUST00000183871
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype Strain: 3622328; 2660793;2446070
FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16139198 splice site probably benign
IGL01346:Ripk2 APN 4 16132775 critical splice donor site probably null
IGL01631:Ripk2 APN 4 16163342 missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16139240 missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16152056 missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0189:Ripk2 UTSW 4 16129125 intron probably null
R1454:Ripk2 UTSW 4 16163239 missense probably damaging 0.96
R1715:Ripk2 UTSW 4 16155192 critical splice acceptor site probably null
R2153:Ripk2 UTSW 4 16132775 critical splice donor site probably null
R2266:Ripk2 UTSW 4 16152011 missense possibly damaging 0.91
R3693:Ripk2 UTSW 4 16127695 missense probably benign
R4412:Ripk2 UTSW 4 16124511 missense probably benign
R4463:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16155073 missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16127663 missense possibly damaging 0.78
R5453:Ripk2 UTSW 4 16151989 missense probably damaging 1.00
R6197:Ripk2 UTSW 4 16163330 missense probably damaging 1.00
R6576:Ripk2 UTSW 4 16131558 intron probably null
R6967:Ripk2 UTSW 4 16158275 critical splice donor site probably null
R7351:Ripk2 UTSW 4 16155048 missense probably damaging 1.00
R7479:Ripk2 UTSW 4 16155154 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCAGCACAGTTTCTAAGTTCACC -3'
(R):5'- ATTGAAAGATTGACGTGGAACC -3'

Sequencing Primer
(F):5'- TCTAAGTTCACCTCTGATATACTGAG -3'
(R):5'- GGTTTAATTAGAAGTGATCTGAACT -3'
Posted On2014-11-11