Incidental Mutation 'R2394:Oog3'
ID247904
Institutional Source Beutler Lab
Gene Symbol Oog3
Ensembl Gene ENSMUSG00000050810
Gene Nameoogenesin 3
Synonyms
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144157557-144162663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144159314 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 238 (D238V)
Ref Sequence ENSEMBL: ENSMUSP00000059834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050933]
Predicted Effect probably benign
Transcript: ENSMUST00000050933
AA Change: D238V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000059834
Gene: ENSMUSG00000050810
AA Change: D238V

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
SCOP:d1a4ya_ 226 428 7e-5 SMART
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Oog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Oog3 APN 4 144158151 missense probably benign 0.00
IGL02517:Oog3 APN 4 144159350 missense probably damaging 1.00
IGL02635:Oog3 APN 4 144158145 missense probably damaging 1.00
R0016:Oog3 UTSW 4 144158071 missense probably damaging 1.00
R0016:Oog3 UTSW 4 144158071 missense probably damaging 1.00
R0269:Oog3 UTSW 4 144160214 missense probably benign 0.10
R0617:Oog3 UTSW 4 144160214 missense probably benign 0.10
R1147:Oog3 UTSW 4 144158412 missense possibly damaging 0.81
R1147:Oog3 UTSW 4 144158412 missense possibly damaging 0.81
R1562:Oog3 UTSW 4 144162599 missense probably damaging 0.98
R1669:Oog3 UTSW 4 144158438 missense probably benign 0.06
R1766:Oog3 UTSW 4 144159122 missense possibly damaging 0.49
R2002:Oog3 UTSW 4 144158105 missense possibly damaging 0.96
R2109:Oog3 UTSW 4 144159512 missense probably damaging 1.00
R4615:Oog3 UTSW 4 144158329 missense probably benign 0.00
R4632:Oog3 UTSW 4 144158128 missense probably benign 0.00
R4816:Oog3 UTSW 4 144159161 missense probably damaging 1.00
R5459:Oog3 UTSW 4 144159245 missense probably benign
R5547:Oog3 UTSW 4 144158028 missense probably benign 0.27
R6811:Oog3 UTSW 4 144159582 missense probably benign 0.00
R6931:Oog3 UTSW 4 144159353 missense probably benign 0.00
R7052:Oog3 UTSW 4 144160457 missense probably damaging 1.00
R7194:Oog3 UTSW 4 144162599 missense probably damaging 0.98
R7312:Oog3 UTSW 4 144160231 missense probably benign 0.08
R7486:Oog3 UTSW 4 144158172 missense probably benign 0.16
Z1088:Oog3 UTSW 4 144158307 missense probably benign 0.00
Z1088:Oog3 UTSW 4 144159636 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGAGGATTTCATTCAGGTTGC -3'
(R):5'- AGGGCAGACTTGATGATTCTG -3'

Sequencing Primer
(F):5'- AGAGTTTCTGGAGACAGG -3'
(R):5'- CAGACTTGATGATTCTGCCACATAC -3'
Posted On2014-11-11