Incidental Mutation 'R2394:Thap8'
ID247909
Institutional Source Beutler Lab
Gene Symbol Thap8
Ensembl Gene ENSMUSG00000013928
Gene NameTHAP domain containing 8
Synonyms
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30280094-30290237 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 30280628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014072] [ENSMUST00000108187] [ENSMUST00000108190] [ENSMUST00000145027]
Predicted Effect unknown
Transcript: ENSMUST00000014072
AA Change: M33L
Predicted Effect unknown
Transcript: ENSMUST00000108187
AA Change: M33L
Predicted Effect probably benign
Transcript: ENSMUST00000108190
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145027
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208866
Meta Mutation Damage Score 0.0444 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Thap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0885:Thap8 UTSW 7 30280669 nonsense probably null
R7314:Thap8 UTSW 7 30289895 missense unknown
R7369:Thap8 UTSW 7 30289952 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAATCACAAAGCTTCCGGG -3'
(R):5'- GCGTACAAAATGTTCCTCGTGC -3'

Sequencing Primer
(F):5'- ATCACAAAGCTTCCGGGTAGGC -3'
(R):5'- GTACAAAATGTTCCTCGTGCTACCG -3'
Posted On2014-11-11