Incidental Mutation 'R2394:Cyp1a1'
ID247915
Institutional Source Beutler Lab
Gene Symbol Cyp1a1
Ensembl Gene ENSMUSG00000032315
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 1
SynonymsP450-1, cytochrome P450 subfamily I, polypeptide 1
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2394 (G1)
Quality Score185
Status Validated
Chromosome9
Chromosomal Location57687928-57703824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57700149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 20 (V20D)
Ref Sequence ENSEMBL: ENSMUSP00000150277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034865] [ENSMUST00000216433]
Predicted Effect probably benign
Transcript: ENSMUST00000034865
AA Change: V20D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034865
Gene: ENSMUSG00000032315
AA Change: V20D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 509 2.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216433
AA Change: V20D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Cyp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Cyp1a1 APN 9 57700707 missense probably damaging 1.00
IGL02427:Cyp1a1 APN 9 57700575 missense probably damaging 1.00
IGL02952:Cyp1a1 APN 9 57702710 missense probably benign
IGL03002:Cyp1a1 APN 9 57702441 splice site probably benign
IGL03085:Cyp1a1 APN 9 57701712 missense possibly damaging 0.89
PIT1430001:Cyp1a1 UTSW 9 57700911 missense probably benign 0.27
R0508:Cyp1a1 UTSW 9 57700305 missense probably benign
R1844:Cyp1a1 UTSW 9 57702697 missense probably benign
R2216:Cyp1a1 UTSW 9 57702069 splice site probably null
R3966:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4056:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4367:Cyp1a1 UTSW 9 57700149 missense probably benign
R4529:Cyp1a1 UTSW 9 57701679 missense probably benign 0.01
R4616:Cyp1a1 UTSW 9 57701756 missense probably benign 0.09
R4656:Cyp1a1 UTSW 9 57702610 missense probably damaging 0.99
R5271:Cyp1a1 UTSW 9 57702838 missense probably benign 0.01
R5324:Cyp1a1 UTSW 9 57702369 missense probably benign 0.13
R6113:Cyp1a1 UTSW 9 57701891 missense probably damaging 1.00
R6189:Cyp1a1 UTSW 9 57700683 missense probably damaging 1.00
R6239:Cyp1a1 UTSW 9 57702078 missense probably benign 0.36
R6382:Cyp1a1 UTSW 9 57700690 missense probably damaging 0.99
R6750:Cyp1a1 UTSW 9 57700256 missense probably benign
R6869:Cyp1a1 UTSW 9 57702784 missense probably benign
R6881:Cyp1a1 UTSW 9 57700719 missense possibly damaging 0.78
R6913:Cyp1a1 UTSW 9 57700293 missense probably damaging 0.98
R7341:Cyp1a1 UTSW 9 57700824 missense probably damaging 0.99
R7450:Cyp1a1 UTSW 9 57702132 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGCTCTGTCCTGCTCTATG -3'
(R):5'- TGAAGCTGTAGAGGTCTGGC -3'

Sequencing Primer
(F):5'- TCTATGCCCAGGGAACAGCTC -3'
(R):5'- TCACCAGGGCCTGCTTGATG -3'
Posted On2014-11-11