Mutagenetix > Incidental Mutation

Incidental Mutation 'R2394:Rnf123'

247916

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

040362-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R2394 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107928869-107957183 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107940735 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 702 (M702T)

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000178267] [ENSMUST00000162355] [ENSMUST00000162753]

AlphaFold

Q5XPI3

Predicted Effect

probably benign
Transcript: ENSMUST00000047746
AA Change: M708T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: M708T

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160249
AA Change: M702T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: M702T

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160649
AA Change: M702T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: M702T

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160841

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

probably benign
Transcript: ENSMUST00000178267
AA Change: M702T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: M702T

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162355
AA Change: M708T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: M708T

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173683

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L13Rik	A	T	7: 29,980,053 (GRCm39)		probably benign	Het
Abca17	T	C	17: 24,500,190 (GRCm39)		probably null	Het
Atxn7	T	C	14: 14,100,237 (GRCm38)	V641A	probably damaging	Het
C3	G	A	17: 57,529,303 (GRCm39)	Q30*	probably null	Het
Ccdc162	A	G	10: 41,445,894 (GRCm39)	I426T	probably damaging	Het
Col9a2	C	G	4: 120,911,455 (GRCm39)	R599G	probably damaging	Het
Cwc27	A	C	13: 104,932,942 (GRCm39)	D253E	probably benign	Het
Cyp1a1	T	A	9: 57,607,432 (GRCm39)	V20D	probably benign	Het
Dmbt1	T	A	7: 130,696,464 (GRCm39)	Y892*	probably null	Het
Dnhd1	T	A	7: 105,369,438 (GRCm39)	Y4354N	probably benign	Het
Dync2li1	T	A	17: 84,952,175 (GRCm39)	I202K	possibly damaging	Het
Dyrk1a	T	A	16: 94,485,991 (GRCm39)	V446E	probably benign	Het
Efcab3	C	A	11: 104,629,121 (GRCm39)	T933K	probably benign	Het
Fam186b	T	C	15: 99,178,058 (GRCm39)	I423V	probably benign	Het
Gm5108	T	C	5: 68,132,475 (GRCm39)		probably benign	Het
Htr3a	A	G	9: 48,817,643 (GRCm39)	V110A	probably benign	Het
Itsn2	C	A	12: 4,757,005 (GRCm39)	S1365Y	possibly damaging	Het
Lrrc46	T	C	11: 96,929,657 (GRCm39)	I60V	probably damaging	Het
Mtrex	A	T	13: 113,019,702 (GRCm39)	Y803N	probably benign	Het
Nlrp14	T	C	7: 106,797,031 (GRCm39)	V307A	probably benign	Het
Nt5c2	A	G	19: 46,878,506 (GRCm39)		probably null	Het
Obox2	C	T	7: 15,130,935 (GRCm39)	P56S	possibly damaging	Het
Olfml2b	A	G	1: 170,477,319 (GRCm39)	I151M	possibly damaging	Het
Oog3	T	A	4: 143,885,884 (GRCm39)	D238V	probably benign	Het
Pde11a	T	C	2: 75,889,405 (GRCm39)	T690A	probably benign	Het
Ppa1	A	G	10: 61,508,163 (GRCm39)		probably benign	Het
Ppfia2	A	G	10: 106,655,351 (GRCm39)	E306G	probably damaging	Het
Ppic	G	A	18: 53,544,119 (GRCm39)	R89C	probably damaging	Het
Ptprk	T	G	10: 28,427,713 (GRCm39)	I764S	probably damaging	Het
Ripk2	T	C	4: 16,132,774 (GRCm39)		probably benign	Het
Slco1b2	T	C	6: 141,615,100 (GRCm39)	I335T	probably damaging	Het
Ssbp1	T	A	6: 40,453,743 (GRCm39)	D96E	probably benign	Het
Tpp2	T	A	1: 44,022,346 (GRCm39)	S915T	possibly damaging	Het
Unc5c	A	T	3: 141,383,892 (GRCm39)	Q90L	probably damaging	Het
Vmn2r57	A	G	7: 41,049,619 (GRCm39)	I710T	possibly damaging	Het
Wdr90	G	A	17: 26,070,429 (GRCm39)	P1104L	probably damaging	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	107,944,594 (GRCm39)	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	107,946,381 (GRCm39)	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	107,929,501 (GRCm39)	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	107,935,437 (GRCm39)	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	107,935,555 (GRCm39)	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	107,948,569 (GRCm39)	splice site	probably benign
IGL02070:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02072:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02073:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02074:Rnf123	APN	9	107,944,088 (GRCm39)	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02080:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02231:Rnf123	APN	9	107,943,598 (GRCm39)	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	107,948,651 (GRCm39)	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	107,939,041 (GRCm39)	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	107,943,547 (GRCm39)	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	107,929,411 (GRCm39)	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02572:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02574:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02586:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02589:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02600:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02601:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02602:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02603:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02609:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02628:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02629:Rnf123	APN	9	107,947,988 (GRCm39)	splice site	probably benign
IGL02629:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02630:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02631:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02632:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02650:Rnf123	APN	9	107,946,947 (GRCm39)	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02691:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02692:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02693:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02713:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02736:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02929:Rnf123	APN	9	107,946,275 (GRCm39)	missense	probably benign
R1175:Rnf123	UTSW	9	107,954,572 (GRCm39)	missense	probably benign
R1465:Rnf123	UTSW	9	107,948,665 (GRCm39)	splice site	probably benign
R1502:Rnf123	UTSW	9	107,945,709 (GRCm39)	splice site	probably null
R1682:Rnf123	UTSW	9	107,954,597 (GRCm39)	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	107,940,125 (GRCm39)	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	107,938,990 (GRCm39)	missense	probably damaging	1.00
R2483:Rnf123	UTSW	9	107,940,720 (GRCm39)	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	107,946,302 (GRCm39)	splice site	probably benign
R3940:Rnf123	UTSW	9	107,941,234 (GRCm39)	splice site	probably benign
R4206:Rnf123	UTSW	9	107,941,162 (GRCm39)	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	107,935,786 (GRCm39)	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	107,929,638 (GRCm39)	splice site	probably null
R4767:Rnf123	UTSW	9	107,929,288 (GRCm39)	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	107,933,290 (GRCm39)	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	107,940,879 (GRCm39)	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5275:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5276:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5294:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5295:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5394:Rnf123	UTSW	9	107,947,930 (GRCm39)	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	107,944,623 (GRCm39)	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	107,947,157 (GRCm39)	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	107,933,252 (GRCm39)	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	107,945,531 (GRCm39)	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	107,940,822 (GRCm39)	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	107,940,882 (GRCm39)	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	107,935,735 (GRCm39)	missense	probably null	1.00
R7092:Rnf123	UTSW	9	107,945,799 (GRCm39)	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	107,933,838 (GRCm39)	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	107,946,228 (GRCm39)	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	107,947,607 (GRCm39)	splice site	probably null
R7468:Rnf123	UTSW	9	107,946,208 (GRCm39)	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	107,947,473 (GRCm39)	nonsense	probably null
R7577:Rnf123	UTSW	9	107,947,818 (GRCm39)	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	107,940,089 (GRCm39)	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	107,945,706 (GRCm39)	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	107,948,363 (GRCm39)	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	107,946,272 (GRCm39)	missense	probably benign
R9052:Rnf123	UTSW	9	107,936,930 (GRCm39)	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	107,940,227 (GRCm39)	splice site	probably benign
R9170:Rnf123	UTSW	9	107,948,375 (GRCm39)	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	107,944,704 (GRCm39)	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	107,929,467 (GRCm39)	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	107,942,905 (GRCm39)	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	107,937,008 (GRCm39)	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	107,954,963 (GRCm39)	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	107,940,180 (GRCm39)	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	107,935,594 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGACTGTGCTTCCTGTGC -3'
(R):5'- AGTTCTACATAGGCCCTAGTCTTGG -3'

Sequencing Primer
(F):5'- GCTTCCTGTGCCCTTGGG -3'
(R):5'- CTAGTCTTGGAAGCCAGACTAGC -3'

Posted On

2014-11-11