Incidental Mutation 'R2394:Ppa1'
ID247919
Institutional Source Beutler Lab
Gene Symbol Ppa1
Ensembl Gene ENSMUSG00000020089
Gene Namepyrophosphatase (inorganic) 1
SynonymsPyp, 2010317E03Rik
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2394 (G1)
Quality Score172
Status Validated
Chromosome10
Chromosomal Location61648552-61674168 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 61672384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020286]
Predicted Effect probably benign
Transcript: ENSMUST00000020286
SMART Domains Protein: ENSMUSP00000020286
Gene: ENSMUSG00000020089

DomainStartEndE-ValueType
Pfam:Pyrophosphatase 46 228 2.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219142
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the inorganic pyrophosphatase (PPase) family. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Studies of a similar protein in bovine suggested a cytoplasmic localization of this enzyme. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Ppa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Ppa1 APN 10 61665436 missense probably benign 0.12
IGL02489:Ppa1 APN 10 61665444 missense probably damaging 0.99
hotpot UTSW 10 61666970 missense probably damaging 1.00
R0635:Ppa1 UTSW 10 61665440 missense probably benign 0.02
R0635:Ppa1 UTSW 10 61666970 missense probably damaging 1.00
R1925:Ppa1 UTSW 10 61651609 nonsense probably null
R2283:Ppa1 UTSW 10 61661009 nonsense probably null
R6180:Ppa1 UTSW 10 61667652 missense probably benign
R6823:Ppa1 UTSW 10 61667603 missense probably damaging 1.00
R6893:Ppa1 UTSW 10 61672403 missense probably benign 0.00
R6999:Ppa1 UTSW 10 61661017 missense probably damaging 1.00
R7298:Ppa1 UTSW 10 61666912 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCCCTAAGAGGCTCGAATCCA -3'
(R):5'- CACATCTACATCAATCTACCCTCCTG -3'

Sequencing Primer
(F):5'- TGTACGTGGTGCACATACAC -3'
(R):5'- TGTGAGGGGATACATTTCCTAAC -3'
Posted On2014-11-11